Incidental Mutation 'R5480:Taf5l'
ID434269
Institutional Source Beutler Lab
Gene Symbol Taf5l
Ensembl Gene ENSMUSG00000038697
Gene NameTATA-box binding protein associated factor 5 like
Synonyms
MMRRC Submission 043041-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5480 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123996318-124021397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124009820 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 4 (V4E)
Ref Sequence ENSEMBL: ENSMUSP00000148808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093039] [ENSMUST00000127664] [ENSMUST00000165628] [ENSMUST00000212010]
Predicted Effect probably benign
Transcript: ENSMUST00000093039
AA Change: V4E

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090726
Gene: ENSMUSG00000038697
AA Change: V4E

DomainStartEndE-ValueType
Pfam:TFIID_NTD2 61 195 8.4e-35 PFAM
WD40 257 296 6.66e-1 SMART
WD40 331 370 3.19e-7 SMART
WD40 373 412 5.95e-7 SMART
WD40 415 454 2.2e-10 SMART
WD40 457 496 1.2e-11 SMART
WD40 499 538 5.3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165628
AA Change: V4E

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128710
Gene: ENSMUSG00000038697
AA Change: V4E

DomainStartEndE-ValueType
Pfam:TFIID_90kDa 55 196 1.2e-43 PFAM
WD40 257 296 6.66e-1 SMART
WD40 331 370 3.19e-7 SMART
WD40 373 412 5.95e-7 SMART
WD40 415 454 2.2e-10 SMART
WD40 457 496 1.2e-11 SMART
WD40 499 538 5.3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211825
Predicted Effect possibly damaging
Transcript: ENSMUST00000212010
AA Change: V4E

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213055
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the WD-repeat TAF5 family of proteins. This gene encodes a protein that is a component of the PCAF histone acetylase complex. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors to facilitate complex assembly and transcription initiation. The encoded protein is structurally similar to one of the histone-like TAFs, TAF5. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,157,999 C2257* probably null Het
Alkbh7 A G 17: 56,999,131 probably benign Het
Alpk2 A G 18: 65,349,908 L343S probably damaging Het
Btbd10 T A 7: 113,316,707 R392W probably damaging Het
Camkv A G 9: 107,946,875 D216G probably damaging Het
Col22a1 T C 15: 71,964,611 D525G probably damaging Het
Dqx1 A T 6: 83,064,803 D542V probably damaging Het
Epha8 T C 4: 136,935,130 T539A probably benign Het
Faap100 T C 11: 120,377,113 E278G probably damaging Het
Fat2 A G 11: 55,310,086 S721P probably damaging Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gfy C A 7: 45,177,233 V394F probably benign Het
Gipr A G 7: 19,160,654 L241P probably damaging Het
Gm5478 A G 15: 101,643,665 S445P probably damaging Het
Ift140 G T 17: 25,020,576 W69L probably damaging Het
Kat6a T A 8: 22,938,307 M1226K possibly damaging Het
Klk12 T G 7: 43,771,058 H140Q probably benign Het
Map3k14 A G 11: 103,239,504 F196L probably benign Het
Mblac2 T A 13: 81,750,276 V257E possibly damaging Het
Pcdha11 A G 18: 37,005,882 E188G probably benign Het
Pdzd7 T C 19: 45,039,285 N250S possibly damaging Het
Phkb A G 8: 85,922,182 D209G probably damaging Het
Pigs T G 11: 78,329,075 I92S possibly damaging Het
Pigz G T 16: 31,944,621 G166C probably damaging Het
Pkd1l2 C A 8: 117,030,649 R1550L probably damaging Het
Pkd2l1 A G 19: 44,192,156 V40A probably benign Het
Plxna1 A T 6: 89,324,634 M1470K probably damaging Het
Polq T A 16: 37,013,290 probably benign Het
Prune2 A G 19: 17,120,947 T1272A possibly damaging Het
Rfwd3 A T 8: 111,273,832 D720E probably damaging Het
Rgs12 C G 5: 34,966,111 Q413E probably benign Het
Rhobtb1 T A 10: 69,270,733 V376D possibly damaging Het
Rrp8 C T 7: 105,734,129 S310N probably damaging Het
S100a3 C T 3: 90,602,284 L79F probably damaging Het
Setbp1 C A 18: 78,858,063 M796I probably damaging Het
Sipa1 A G 19: 5,659,630 L254P possibly damaging Het
Slc4a7 C G 14: 14,782,138 H964Q probably damaging Het
Strc G T 2: 121,364,819 P1661Q probably benign Het
Tbc1d15 T C 10: 115,233,218 E82G probably damaging Het
Thada A G 17: 84,432,254 S858P probably benign Het
Ticrr T C 7: 79,660,809 V157A probably damaging Het
Trim21 T C 7: 102,559,256 T419A probably benign Het
Vmn2r60 G T 7: 42,135,730 W122L probably damaging Het
Vwa3b C A 1: 37,100,706 Y369* probably null Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Other mutations in Taf5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Taf5l APN 8 124003458 missense possibly damaging 0.94
IGL03371:Taf5l APN 8 123997986 missense possibly damaging 0.52
Invalid UTSW 8 124002975 critical splice donor site probably null
R0017:Taf5l UTSW 8 124003644 missense probably damaging 1.00
R1708:Taf5l UTSW 8 124009770 nonsense probably null
R1813:Taf5l UTSW 8 124003413 missense probably damaging 1.00
R1861:Taf5l UTSW 8 123997990 missense probably damaging 1.00
R1896:Taf5l UTSW 8 124003413 missense probably damaging 1.00
R4570:Taf5l UTSW 8 123997550 missense probably damaging 1.00
R4656:Taf5l UTSW 8 123998105 missense probably benign
R5294:Taf5l UTSW 8 124008218 missense probably benign 0.11
R5335:Taf5l UTSW 8 124003651 missense probably damaging 1.00
R5905:Taf5l UTSW 8 124002975 critical splice donor site probably null
R6028:Taf5l UTSW 8 124002975 critical splice donor site probably null
R7105:Taf5l UTSW 8 124003212 missense probably damaging 1.00
X0024:Taf5l UTSW 8 123998021 missense probably benign 0.04
Z1088:Taf5l UTSW 8 123997338 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGCTCACTGAAGCTTGGTAG -3'
(R):5'- CAAAGAAGCTGGCTCCATGG -3'

Sequencing Primer
(F):5'- GGTAGCCTACCCTTTGCTGAGAAC -3'
(R):5'- CTCCATGGCCTTTGGAAAAGTAG -3'
Posted On2016-10-06