Incidental Mutation 'R5480:Camkv'
ID434270
Institutional Source Beutler Lab
Gene Symbol Camkv
Ensembl Gene ENSMUSG00000032936
Gene NameCaM kinase-like vesicle-associated
Synonyms
MMRRC Submission 043041-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5480 (G1)
Quality Score217
Status Validated
Chromosome9
Chromosomal Location107935674-107949691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107946875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 216 (D216G)
Ref Sequence ENSEMBL: ENSMUSP00000141444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035700] [ENSMUST00000049348] [ENSMUST00000193533] [ENSMUST00000194206] [ENSMUST00000194271] [ENSMUST00000195219]
Predicted Effect probably damaging
Transcript: ENSMUST00000035700
AA Change: D244G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040430
Gene: ENSMUSG00000032936
AA Change: D244G

DomainStartEndE-ValueType
S_TKc 24 286 4.21e-81 SMART
low complexity region 332 385 N/A INTRINSIC
internal_repeat_1 392 425 3.43e-15 PROSPERO
internal_repeat_1 416 449 3.43e-15 PROSPERO
low complexity region 461 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049348
SMART Domains Protein: ENSMUSP00000040001
Gene: ENSMUSG00000032586

DomainStartEndE-ValueType
RING 7 49 6.68e-6 SMART
coiled coil region 70 278 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192567
Predicted Effect probably benign
Transcript: ENSMUST00000193533
Predicted Effect probably damaging
Transcript: ENSMUST00000194206
AA Change: D216G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141444
Gene: ENSMUSG00000032936
AA Change: D216G

DomainStartEndE-ValueType
STYKc 24 258 2.3e-8 SMART
low complexity region 304 357 N/A INTRINSIC
internal_repeat_1 364 397 2.93e-15 PROSPERO
internal_repeat_1 388 421 2.93e-15 PROSPERO
low complexity region 433 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194271
SMART Domains Protein: ENSMUSP00000141689
Gene: ENSMUSG00000032586

DomainStartEndE-ValueType
RING 7 49 3.2e-8 SMART
coiled coil region 54 143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194538
Predicted Effect probably benign
Transcript: ENSMUST00000195219
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,157,999 C2257* probably null Het
Alkbh7 A G 17: 56,999,131 probably benign Het
Alpk2 A G 18: 65,349,908 L343S probably damaging Het
Btbd10 T A 7: 113,316,707 R392W probably damaging Het
Col22a1 T C 15: 71,964,611 D525G probably damaging Het
Dqx1 A T 6: 83,064,803 D542V probably damaging Het
Epha8 T C 4: 136,935,130 T539A probably benign Het
Faap100 T C 11: 120,377,113 E278G probably damaging Het
Fat2 A G 11: 55,310,086 S721P probably damaging Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gfy C A 7: 45,177,233 V394F probably benign Het
Gipr A G 7: 19,160,654 L241P probably damaging Het
Gm5478 A G 15: 101,643,665 S445P probably damaging Het
Ift140 G T 17: 25,020,576 W69L probably damaging Het
Kat6a T A 8: 22,938,307 M1226K possibly damaging Het
Klk12 T G 7: 43,771,058 H140Q probably benign Het
Map3k14 A G 11: 103,239,504 F196L probably benign Het
Mblac2 T A 13: 81,750,276 V257E possibly damaging Het
Pcdha11 A G 18: 37,005,882 E188G probably benign Het
Pdzd7 T C 19: 45,039,285 N250S possibly damaging Het
Phkb A G 8: 85,922,182 D209G probably damaging Het
Pigs T G 11: 78,329,075 I92S possibly damaging Het
Pigz G T 16: 31,944,621 G166C probably damaging Het
Pkd1l2 C A 8: 117,030,649 R1550L probably damaging Het
Pkd2l1 A G 19: 44,192,156 V40A probably benign Het
Plxna1 A T 6: 89,324,634 M1470K probably damaging Het
Polq T A 16: 37,013,290 probably benign Het
Prune2 A G 19: 17,120,947 T1272A possibly damaging Het
Rfwd3 A T 8: 111,273,832 D720E probably damaging Het
Rgs12 C G 5: 34,966,111 Q413E probably benign Het
Rhobtb1 T A 10: 69,270,733 V376D possibly damaging Het
Rrp8 C T 7: 105,734,129 S310N probably damaging Het
S100a3 C T 3: 90,602,284 L79F probably damaging Het
Setbp1 C A 18: 78,858,063 M796I probably damaging Het
Sipa1 A G 19: 5,659,630 L254P possibly damaging Het
Slc4a7 C G 14: 14,782,138 H964Q probably damaging Het
Strc G T 2: 121,364,819 P1661Q probably benign Het
Taf5l A T 8: 124,009,820 V4E possibly damaging Het
Tbc1d15 T C 10: 115,233,218 E82G probably damaging Het
Thada A G 17: 84,432,254 S858P probably benign Het
Ticrr T C 7: 79,660,809 V157A probably damaging Het
Trim21 T C 7: 102,559,256 T419A probably benign Het
Vmn2r60 G T 7: 42,135,730 W122L probably damaging Het
Vwa3b C A 1: 37,100,706 Y369* probably null Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Other mutations in Camkv
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0288:Camkv UTSW 9 107946356 missense probably damaging 1.00
R0834:Camkv UTSW 9 107945846 missense probably damaging 1.00
R1919:Camkv UTSW 9 107947088 missense possibly damaging 0.89
R1996:Camkv UTSW 9 107947121 missense probably damaging 1.00
R2165:Camkv UTSW 9 107945600 missense possibly damaging 0.48
R3943:Camkv UTSW 9 107947983 missense possibly damaging 0.70
R4006:Camkv UTSW 9 107946641 missense probably damaging 1.00
R4357:Camkv UTSW 9 107947946 missense probably benign 0.27
R4406:Camkv UTSW 9 107946219 critical splice donor site probably null
R4601:Camkv UTSW 9 107946096 missense probably damaging 0.99
R5078:Camkv UTSW 9 107945373 missense probably damaging 0.99
R5175:Camkv UTSW 9 107947382 missense probably damaging 1.00
R5373:Camkv UTSW 9 107946889 missense probably benign 0.05
R5379:Camkv UTSW 9 107945346 missense probably damaging 0.99
R5484:Camkv UTSW 9 107946146 missense probably damaging 1.00
R6335:Camkv UTSW 9 107946695 critical splice donor site probably null
R6730:Camkv UTSW 9 107948317 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACACAATTGGGCTTGCAGC -3'
(R):5'- TCACCATTCGTGGGAGATGG -3'

Sequencing Primer
(F):5'- CCAGGTGGGCTGGACAATTAC -3'
(R):5'- ACCTCCATCAGCCTGGTGAC -3'
Posted On2016-10-06