Incidental Mutation 'R5480:Tbc1d15'
ID434272
Institutional Source Beutler Lab
Gene Symbol Tbc1d15
Ensembl Gene ENSMUSG00000020130
Gene NameTBC1 domain family, member 15
SynonymsLy6dl, 4432405K22Rik
MMRRC Submission 043041-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R5480 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location115197872-115251467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115233218 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 82 (E82G)
Ref Sequence ENSEMBL: ENSMUSP00000020339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020339]
Predicted Effect probably damaging
Transcript: ENSMUST00000020339
AA Change: E82G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020339
Gene: ENSMUSG00000020130
AA Change: E82G

DomainStartEndE-ValueType
Pfam:DUF3548 6 224 1.3e-87 PFAM
TBC 326 564 1.14e-50 SMART
Blast:TBC 602 671 5e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219274
Meta Mutation Damage Score 0.506 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-like proteins in brain-GTPase activating protein superfamily that share a conserved Tre-2/Bub2/Cdc16 domain. The encoded protein interacts with Ras-like protein in brain 5A and may function as a regulator of intracellular trafficking. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,157,999 C2257* probably null Het
Alkbh7 A G 17: 56,999,131 probably benign Het
Alpk2 A G 18: 65,349,908 L343S probably damaging Het
Btbd10 T A 7: 113,316,707 R392W probably damaging Het
Camkv A G 9: 107,946,875 D216G probably damaging Het
Col22a1 T C 15: 71,964,611 D525G probably damaging Het
Dqx1 A T 6: 83,064,803 D542V probably damaging Het
Epha8 T C 4: 136,935,130 T539A probably benign Het
Faap100 T C 11: 120,377,113 E278G probably damaging Het
Fat2 A G 11: 55,310,086 S721P probably damaging Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gfy C A 7: 45,177,233 V394F probably benign Het
Gipr A G 7: 19,160,654 L241P probably damaging Het
Gm5478 A G 15: 101,643,665 S445P probably damaging Het
Ift140 G T 17: 25,020,576 W69L probably damaging Het
Kat6a T A 8: 22,938,307 M1226K possibly damaging Het
Klk12 T G 7: 43,771,058 H140Q probably benign Het
Map3k14 A G 11: 103,239,504 F196L probably benign Het
Mblac2 T A 13: 81,750,276 V257E possibly damaging Het
Pcdha11 A G 18: 37,005,882 E188G probably benign Het
Pdzd7 T C 19: 45,039,285 N250S possibly damaging Het
Phkb A G 8: 85,922,182 D209G probably damaging Het
Pigs T G 11: 78,329,075 I92S possibly damaging Het
Pigz G T 16: 31,944,621 G166C probably damaging Het
Pkd1l2 C A 8: 117,030,649 R1550L probably damaging Het
Pkd2l1 A G 19: 44,192,156 V40A probably benign Het
Plxna1 A T 6: 89,324,634 M1470K probably damaging Het
Polq T A 16: 37,013,290 probably benign Het
Prune2 A G 19: 17,120,947 T1272A possibly damaging Het
Rfwd3 A T 8: 111,273,832 D720E probably damaging Het
Rgs12 C G 5: 34,966,111 Q413E probably benign Het
Rhobtb1 T A 10: 69,270,733 V376D possibly damaging Het
Rrp8 C T 7: 105,734,129 S310N probably damaging Het
S100a3 C T 3: 90,602,284 L79F probably damaging Het
Setbp1 C A 18: 78,858,063 M796I probably damaging Het
Sipa1 A G 19: 5,659,630 L254P possibly damaging Het
Slc4a7 C G 14: 14,782,138 H964Q probably damaging Het
Strc G T 2: 121,364,819 P1661Q probably benign Het
Taf5l A T 8: 124,009,820 V4E possibly damaging Het
Thada A G 17: 84,432,254 S858P probably benign Het
Ticrr T C 7: 79,660,809 V157A probably damaging Het
Trim21 T C 7: 102,559,256 T419A probably benign Het
Vmn2r60 G T 7: 42,135,730 W122L probably damaging Het
Vwa3b C A 1: 37,100,706 Y369* probably null Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Other mutations in Tbc1d15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Tbc1d15 APN 10 115209641 nonsense probably null
IGL01161:Tbc1d15 APN 10 115202530 missense probably benign 0.01
IGL02458:Tbc1d15 APN 10 115229206 missense probably damaging 0.99
IGL03145:Tbc1d15 APN 10 115202516 missense probably benign 0.03
R0140:Tbc1d15 UTSW 10 115220219 missense probably damaging 0.99
R0466:Tbc1d15 UTSW 10 115219172 missense probably damaging 1.00
R0617:Tbc1d15 UTSW 10 115239299 missense probably damaging 1.00
R0633:Tbc1d15 UTSW 10 115220310 missense probably benign 0.00
R1526:Tbc1d15 UTSW 10 115203230 missense probably benign 0.38
R1699:Tbc1d15 UTSW 10 115220314 missense probably benign 0.05
R1727:Tbc1d15 UTSW 10 115210225 missense probably damaging 1.00
R2063:Tbc1d15 UTSW 10 115229173 missense probably benign
R2111:Tbc1d15 UTSW 10 115240914 missense possibly damaging 0.88
R4751:Tbc1d15 UTSW 10 115202587 missense probably damaging 1.00
R5318:Tbc1d15 UTSW 10 115208969 nonsense probably null
R5746:Tbc1d15 UTSW 10 115210279 missense probably damaging 1.00
R5891:Tbc1d15 UTSW 10 115220308 missense probably benign 0.20
R6012:Tbc1d15 UTSW 10 115219207 missense probably damaging 1.00
R6306:Tbc1d15 UTSW 10 115233243 missense possibly damaging 0.91
R6989:Tbc1d15 UTSW 10 115209569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCACGCACATTAAGGAATC -3'
(R):5'- TGTTGATTGGCAGCCCTGAC -3'

Sequencing Primer
(F):5'- AGGAATCAGATCATCTTCGTGG -3'
(R):5'- CAGCCCTGACTGCAAAGAGTG -3'
Posted On2016-10-06