Mutagenetix > Incidental Mutation

Incidental Mutation 'R0490:Spag17'

43428

Institutional Source

Beutler Lab

Gene Symbol

Spag17

Ensembl Gene

ENSMUSG00000027867

Gene Name

sperm associated antigen 17

Synonyms

PF6, 4931427F14Rik

MMRRC Submission

038688-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0490 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99792722-100050638 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 99889727 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 199 (R199W)

Ref Sequence

ENSEMBL: ENSMUSP00000134066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164539]

AlphaFold

Q5S003

Predicted Effect

probably damaging
Transcript: ENSMUST00000164539
AA Change: R199W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: R199W

Domain	Start	End	E-Value	Type
low complexity region	155	170	N/A	INTRINSIC
low complexity region	384	400	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
coiled coil region	909	964	N/A	INTRINSIC
coiled coil region	1079	1120	N/A	INTRINSIC
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1192	1205	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1223	1238	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1931	1942	N/A	INTRINSIC
Pfam:PapD-like	2171	2277	1.2e-15	PFAM

Meta Mutation Damage Score

0.2121

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.2%
20x: 92.2%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	T	A	10: 29,103,338 (GRCm39)	Y640N	probably damaging	Het
Adamts9	T	A	6: 92,849,847 (GRCm39)	Q402L	probably benign	Het
Als2cl	A	G	9: 110,724,414 (GRCm39)	T750A	probably benign	Het
Ank1	C	A	8: 23,597,890 (GRCm39)		probably benign	Het
Ap4e1	T	A	2: 126,888,106 (GRCm39)	N404K	probably damaging	Het
Atf7ip	G	T	6: 136,586,190 (GRCm39)		probably benign	Het
Bean1	A	T	8: 104,941,660 (GRCm39)	T169S	possibly damaging	Het
Bod1l	G	T	5: 41,979,235 (GRCm39)	T693N	probably damaging	Het
Ccdc81	A	T	7: 89,536,970 (GRCm39)	V226D	probably benign	Het
Cd48	A	G	1: 171,532,445 (GRCm39)	*241W	probably null	Het
Cdon	C	A	9: 35,363,978 (GRCm39)	S32Y	probably damaging	Het
Cers3	A	G	7: 66,423,438 (GRCm39)	S128G	possibly damaging	Het
Cntn6	T	C	6: 104,810,879 (GRCm39)	V641A	possibly damaging	Het
Col6a4	G	A	9: 105,890,969 (GRCm39)	T1775I	probably damaging	Het
Dnah8	T	C	17: 30,919,393 (GRCm39)	V1122A	probably benign	Het
Dst	G	T	1: 34,346,449 (GRCm39)	G5102*	probably null	Het
Dvl3	C	T	16: 20,346,173 (GRCm39)		probably benign	Het
Epha5	G	T	5: 84,255,833 (GRCm39)		probably benign	Het
Fscb	G	A	12: 64,519,661 (GRCm39)	P602S	unknown	Het
Fxn	A	G	19: 24,254,543 (GRCm39)		probably null	Het
Gipc2	A	G	3: 151,808,291 (GRCm39)	L254P	possibly damaging	Het
Gm973	C	T	1: 59,597,393 (GRCm39)		probably benign	Het
Gng8	A	G	7: 16,628,908 (GRCm39)	T14A	probably benign	Het
Gsdmc3	C	T	15: 63,732,099 (GRCm39)	G309D	possibly damaging	Het
Gsr	T	A	8: 34,161,540 (GRCm39)		probably benign	Het
Gtdc1	A	T	2: 44,525,052 (GRCm39)	D152E	probably benign	Het
Herc1	A	G	9: 66,392,281 (GRCm39)	D4063G	probably damaging	Het
Hsdl2	C	T	4: 59,612,814 (GRCm39)		probably benign	Het
Iqgap3	T	C	3: 88,021,363 (GRCm39)		probably benign	Het
Kcnj10	A	G	1: 172,197,019 (GRCm39)	T178A	probably damaging	Het
Lama5	T	A	2: 179,821,962 (GRCm39)	I2958F	possibly damaging	Het
Lnx1	T	A	5: 74,781,008 (GRCm39)		probably null	Het
Lpl	A	G	8: 69,349,343 (GRCm39)	R290G	probably damaging	Het
Mamdc4	C	T	2: 25,453,593 (GRCm39)	R1196K	probably benign	Het
Mogat2	T	C	7: 98,872,351 (GRCm39)	S167G	probably benign	Het
Nek8	T	A	11: 78,058,555 (GRCm39)	I582F	probably benign	Het
Notch4	T	A	17: 34,801,864 (GRCm39)	D1237E	probably damaging	Het
Or2y8	A	G	11: 52,035,493 (GRCm39)	I288T	probably damaging	Het
Or5b104	A	G	19: 13,072,176 (GRCm39)	Y279H	probably damaging	Het
Or5b119	G	A	19: 13,456,857 (GRCm39)	A235V	probably damaging	Het
Or9i14	A	G	19: 13,792,219 (GRCm39)	L245P	probably damaging	Het
Pcdhb8	T	C	18: 37,489,833 (GRCm39)	S504P	probably damaging	Het
Pigs	T	C	11: 78,226,451 (GRCm39)	S223P	probably damaging	Het
Prkch	A	G	12: 73,806,450 (GRCm39)	I566V	probably damaging	Het
Ptpn22	T	C	3: 103,793,495 (GRCm39)	S549P	probably damaging	Het
Rita1	A	T	5: 120,749,630 (GRCm39)	F28I	probably damaging	Het
Rpgrip1l	A	T	8: 92,026,473 (GRCm39)		probably benign	Het
Slc1a1	A	G	19: 28,874,931 (GRCm39)	K170E	probably benign	Het
Tas2r116	T	C	6: 132,832,984 (GRCm39)	V195A	probably benign	Het
Trav7d-3	C	A	14: 52,982,007 (GRCm39)		probably benign	Het
Trim15	T	C	17: 37,177,247 (GRCm39)	K138E	probably benign	Het
Ttn	T	A	2: 76,539,174 (GRCm39)	H34604L	probably benign	Het
Ttn	C	T	2: 76,577,876 (GRCm39)	R16012K	probably damaging	Het
Zfp948	T	C	17: 21,808,296 (GRCm39)	V496A	probably benign	Het
Zfy2	A	T	Y: 2,106,620 (GRCm39)	S671R	possibly damaging	Het
Zswim1	T	A	2: 164,667,203 (GRCm39)	Y152N	possibly damaging	Het

Other mutations in Spag17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Spag17	APN	3	99,970,691 (GRCm39)	missense	probably benign	0.00
IGL01143:Spag17	APN	3	99,846,614 (GRCm39)	missense	probably benign	0.00
IGL01329:Spag17	APN	3	100,002,865 (GRCm39)	missense	probably benign	0.16
IGL01393:Spag17	APN	3	99,934,926 (GRCm39)	missense	possibly damaging	0.53
IGL01617:Spag17	APN	3	100,016,824 (GRCm39)	missense	possibly damaging	0.65
IGL01705:Spag17	APN	3	99,930,046 (GRCm39)	missense	probably benign	0.01
IGL01928:Spag17	APN	3	99,847,390 (GRCm39)	splice site	probably benign
IGL01981:Spag17	APN	3	99,966,149 (GRCm39)	missense	probably benign	0.03
IGL02435:Spag17	APN	3	99,889,760 (GRCm39)	missense	possibly damaging	0.53
IGL02452:Spag17	APN	3	99,934,707 (GRCm39)	missense	probably benign	0.00
IGL02465:Spag17	APN	3	99,983,187 (GRCm39)	missense	probably damaging	0.96
IGL02615:Spag17	APN	3	99,979,401 (GRCm39)	missense	probably benign	0.09
IGL02751:Spag17	APN	3	99,918,110 (GRCm39)	nonsense	probably null
IGL02803:Spag17	APN	3	100,016,713 (GRCm39)	missense	probably benign
IGL02898:Spag17	APN	3	100,008,702 (GRCm39)	missense	probably benign	0.00
IGL03037:Spag17	APN	3	99,979,486 (GRCm39)	splice site	probably null
IGL03068:Spag17	APN	3	99,987,521 (GRCm39)	missense	probably benign	0.35
IGL03131:Spag17	APN	3	99,918,075 (GRCm39)	missense	possibly damaging	0.85
IGL03224:Spag17	APN	3	99,918,156 (GRCm39)	missense	possibly damaging	0.53
FR4342:Spag17	UTSW	3	99,963,568 (GRCm39)	small insertion	probably benign
FR4342:Spag17	UTSW	3	99,963,565 (GRCm39)	small insertion	probably benign
FR4548:Spag17	UTSW	3	99,963,570 (GRCm39)	small insertion	probably benign
FR4589:Spag17	UTSW	3	99,963,574 (GRCm39)	small insertion	probably benign
FR4589:Spag17	UTSW	3	99,963,561 (GRCm39)	small insertion	probably benign
FR4737:Spag17	UTSW	3	99,963,573 (GRCm39)	small insertion	probably benign
FR4976:Spag17	UTSW	3	99,963,571 (GRCm39)	small insertion	probably benign
FR4976:Spag17	UTSW	3	99,963,570 (GRCm39)	small insertion	probably benign
N/A:Spag17	UTSW	3	99,889,570 (GRCm39)	splice site	probably benign
PIT4504001:Spag17	UTSW	3	100,010,426 (GRCm39)	critical splice acceptor site	probably null
PIT4514001:Spag17	UTSW	3	99,920,527 (GRCm39)	missense	possibly damaging	0.53
R0107:Spag17	UTSW	3	99,958,103 (GRCm39)	missense	possibly damaging	0.72
R0230:Spag17	UTSW	3	100,014,143 (GRCm39)	missense	probably benign	0.08
R0243:Spag17	UTSW	3	99,992,684 (GRCm39)	missense	probably benign	0.04
R0321:Spag17	UTSW	3	100,008,719 (GRCm39)	missense	probably damaging	0.99
R0375:Spag17	UTSW	3	99,934,906 (GRCm39)	missense	probably benign
R0417:Spag17	UTSW	3	99,972,870 (GRCm39)	missense	probably benign	0.11
R0537:Spag17	UTSW	3	100,032,618 (GRCm39)	missense	probably damaging	0.98
R0714:Spag17	UTSW	3	99,987,472 (GRCm39)	missense	probably damaging	0.97
R0844:Spag17	UTSW	3	99,912,101 (GRCm39)	missense	probably benign
R0919:Spag17	UTSW	3	99,979,259 (GRCm39)	splice site	probably benign
R0926:Spag17	UTSW	3	99,979,432 (GRCm39)	missense	probably benign
R1037:Spag17	UTSW	3	100,010,433 (GRCm39)	missense	probably benign	0.01
R1075:Spag17	UTSW	3	100,000,992 (GRCm39)	missense	probably damaging	0.99
R1109:Spag17	UTSW	3	99,934,667 (GRCm39)	missense	possibly damaging	0.86
R1213:Spag17	UTSW	3	100,002,954 (GRCm39)	missense	probably benign	0.01
R1221:Spag17	UTSW	3	99,889,584 (GRCm39)	missense	possibly damaging	0.72
R1576:Spag17	UTSW	3	99,846,679 (GRCm39)	missense	possibly damaging	0.73
R1586:Spag17	UTSW	3	99,929,068 (GRCm39)	missense	possibly damaging	0.53
R1768:Spag17	UTSW	3	99,934,668 (GRCm39)	missense	possibly damaging	0.53
R1782:Spag17	UTSW	3	99,918,070 (GRCm39)	missense	probably benign	0.02
R1789:Spag17	UTSW	3	99,846,672 (GRCm39)	missense	possibly damaging	0.73
R1945:Spag17	UTSW	3	99,847,298 (GRCm39)	missense	probably benign
R2065:Spag17	UTSW	3	99,920,524 (GRCm39)	missense	probably benign	0.03
R2118:Spag17	UTSW	3	99,956,556 (GRCm39)	missense	possibly damaging	0.72
R2265:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2266:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2267:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2268:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2271:Spag17	UTSW	3	100,014,113 (GRCm39)	missense	probably damaging	1.00
R2389:Spag17	UTSW	3	100,014,153 (GRCm39)	missense	probably benign	0.27
R2420:Spag17	UTSW	3	99,934,935 (GRCm39)	missense	probably benign
R2422:Spag17	UTSW	3	99,934,935 (GRCm39)	missense	probably benign
R2423:Spag17	UTSW	3	100,010,772 (GRCm39)	missense	probably benign
R3407:Spag17	UTSW	3	99,992,615 (GRCm39)	missense	probably benign	0.09
R3801:Spag17	UTSW	3	99,961,169 (GRCm39)	missense	possibly damaging	0.53
R3856:Spag17	UTSW	3	100,014,075 (GRCm39)	missense	probably damaging	1.00
R4021:Spag17	UTSW	3	99,956,546 (GRCm39)	missense	probably benign	0.00
R4022:Spag17	UTSW	3	99,956,546 (GRCm39)	missense	probably benign	0.00
R4408:Spag17	UTSW	3	100,010,694 (GRCm39)	missense	probably benign
R4468:Spag17	UTSW	3	99,992,682 (GRCm39)	missense	probably damaging	0.98
R4540:Spag17	UTSW	3	99,995,697 (GRCm39)	missense	probably damaging	1.00
R4621:Spag17	UTSW	3	100,010,559 (GRCm39)	missense	probably benign	0.08
R4622:Spag17	UTSW	3	100,010,559 (GRCm39)	missense	probably benign	0.08
R4756:Spag17	UTSW	3	100,010,701 (GRCm39)	missense	possibly damaging	0.68
R4797:Spag17	UTSW	3	99,891,795 (GRCm39)	missense	possibly damaging	0.70
R4855:Spag17	UTSW	3	99,970,649 (GRCm39)	missense	probably benign	0.02
R4887:Spag17	UTSW	3	99,958,147 (GRCm39)	missense	probably damaging	1.00
R4962:Spag17	UTSW	3	99,934,939 (GRCm39)	missense	probably benign
R5030:Spag17	UTSW	3	99,992,657 (GRCm39)	nonsense	probably null
R5042:Spag17	UTSW	3	99,979,465 (GRCm39)	missense	probably damaging	1.00
R5074:Spag17	UTSW	3	99,987,434 (GRCm39)	missense	possibly damaging	0.94
R5195:Spag17	UTSW	3	100,008,704 (GRCm39)	missense	probably benign	0.16
R5200:Spag17	UTSW	3	99,970,787 (GRCm39)	nonsense	probably null
R5267:Spag17	UTSW	3	99,969,264 (GRCm39)	missense	probably damaging	0.98
R5360:Spag17	UTSW	3	100,016,726 (GRCm39)	missense	probably benign	0.00
R5444:Spag17	UTSW	3	99,963,468 (GRCm39)	missense	probably benign	0.06
R5498:Spag17	UTSW	3	100,010,661 (GRCm39)	missense	possibly damaging	0.83
R5503:Spag17	UTSW	3	99,934,560 (GRCm39)	missense	possibly damaging	0.72
R5540:Spag17	UTSW	3	99,963,588 (GRCm39)	missense	possibly damaging	0.91
R5547:Spag17	UTSW	3	99,963,468 (GRCm39)	missense	probably benign	0.06
R5575:Spag17	UTSW	3	99,961,138 (GRCm39)	missense	possibly damaging	0.85
R5629:Spag17	UTSW	3	99,987,435 (GRCm39)	missense	probably benign	0.33
R5639:Spag17	UTSW	3	99,963,482 (GRCm39)	missense	probably damaging	1.00
R5842:Spag17	UTSW	3	99,846,566 (GRCm39)	missense	possibly damaging	0.85
R5976:Spag17	UTSW	3	100,003,107 (GRCm39)	nonsense	probably null
R6082:Spag17	UTSW	3	100,031,501 (GRCm39)	missense	possibly damaging	0.46
R6228:Spag17	UTSW	3	99,929,918 (GRCm39)	missense	probably benign	0.33
R6254:Spag17	UTSW	3	99,972,901 (GRCm39)	missense	probably benign	0.03
R6321:Spag17	UTSW	3	99,995,743 (GRCm39)	missense	probably benign	0.05
R6446:Spag17	UTSW	3	100,010,448 (GRCm39)	missense	probably benign
R6687:Spag17	UTSW	3	100,000,266 (GRCm39)	missense	probably benign	0.07
R6853:Spag17	UTSW	3	99,920,551 (GRCm39)	missense	possibly damaging	0.86
R6946:Spag17	UTSW	3	99,911,999 (GRCm39)	missense	possibly damaging	0.53
R6953:Spag17	UTSW	3	99,942,291 (GRCm39)	missense	possibly damaging	0.53
R7038:Spag17	UTSW	3	99,891,925 (GRCm39)	missense	probably benign	0.00
R7084:Spag17	UTSW	3	99,846,586 (GRCm39)	missense	probably benign	0.18
R7126:Spag17	UTSW	3	100,008,751 (GRCm39)	missense	probably benign	0.00
R7144:Spag17	UTSW	3	99,934,717 (GRCm39)	splice site	probably null
R7198:Spag17	UTSW	3	100,002,888 (GRCm39)	missense	probably benign	0.02
R7318:Spag17	UTSW	3	99,847,299 (GRCm39)	missense	probably benign	0.00
R7403:Spag17	UTSW	3	99,846,691 (GRCm39)	missense	possibly damaging	0.53
R7409:Spag17	UTSW	3	99,934,547 (GRCm39)	missense	possibly damaging	0.73
R7409:Spag17	UTSW	3	99,941,475 (GRCm39)	missense	probably benign	0.00
R7537:Spag17	UTSW	3	99,846,563 (GRCm39)	missense	possibly damaging	0.96
R7609:Spag17	UTSW	3	100,002,911 (GRCm39)	nonsense	probably null
R7772:Spag17	UTSW	3	99,987,434 (GRCm39)	missense	probably damaging	0.98
R7842:Spag17	UTSW	3	99,961,174 (GRCm39)	missense	probably benign	0.18
R7963:Spag17	UTSW	3	99,929,954 (GRCm39)	missense	probably benign	0.02
R8168:Spag17	UTSW	3	99,942,300 (GRCm39)	missense	possibly damaging	0.96
R8291:Spag17	UTSW	3	99,968,166 (GRCm39)	missense	probably benign
R8347:Spag17	UTSW	3	99,934,957 (GRCm39)	missense	probably benign
R8383:Spag17	UTSW	3	99,992,708 (GRCm39)	missense	probably damaging	0.98
R8474:Spag17	UTSW	3	99,934,586 (GRCm39)	missense	probably benign	0.00
R8528:Spag17	UTSW	3	100,031,501 (GRCm39)	missense	possibly damaging	0.46
R8804:Spag17	UTSW	3	99,874,506 (GRCm39)	missense	probably benign
R8809:Spag17	UTSW	3	99,889,738 (GRCm39)	missense	probably benign	0.33
R8818:Spag17	UTSW	3	99,920,543 (GRCm39)	missense	probably benign	0.02
R8830:Spag17	UTSW	3	100,032,751 (GRCm39)	missense	possibly damaging	0.77
R8890:Spag17	UTSW	3	99,911,994 (GRCm39)	missense	possibly damaging	0.73
R9008:Spag17	UTSW	3	99,934,942 (GRCm39)	missense	possibly damaging	0.73
R9095:Spag17	UTSW	3	99,912,092 (GRCm39)	missense	possibly damaging	0.86
R9143:Spag17	UTSW	3	99,934,906 (GRCm39)	missense	probably benign
R9182:Spag17	UTSW	3	99,966,158 (GRCm39)	missense	possibly damaging	0.92
R9211:Spag17	UTSW	3	100,032,614 (GRCm39)	critical splice acceptor site	probably benign
R9344:Spag17	UTSW	3	100,010,793 (GRCm39)	missense	probably benign	0.01
R9354:Spag17	UTSW	3	99,934,905 (GRCm39)	missense	probably benign
R9527:Spag17	UTSW	3	99,970,777 (GRCm39)	missense	probably damaging	1.00
R9658:Spag17	UTSW	3	99,934,932 (GRCm39)	missense	possibly damaging	0.93
R9738:Spag17	UTSW	3	99,934,526 (GRCm39)	missense	possibly damaging	0.53
X0025:Spag17	UTSW	3	100,008,767 (GRCm39)	missense	probably benign	0.31
Z1088:Spag17	UTSW	3	100,002,946 (GRCm39)	missense	probably benign	0.09
Z1176:Spag17	UTSW	3	99,920,309 (GRCm39)	missense	probably benign	0.18
Z1177:Spag17	UTSW	3	99,995,715 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGGAAACCTTTGCTTACTCACAAG -3'
(R):5'- TTCAATCTGAGTGCCACAGAGCATAG -3'

Sequencing Primer
(F):5'- CTTACTCACAAGATGACTTGGAGG -3'
(R):5'- GGTGACTCTTAAAGCCCTATTCTGG -3'

Posted On

2013-05-23