Incidental Mutation 'R5480:Pigz'
ID434282
Institutional Source Beutler Lab
Gene Symbol Pigz
Ensembl Gene ENSMUSG00000045625
Gene Namephosphatidylinositol glycan anchor biosynthesis, class Z
Synonyms
MMRRC Submission 043041-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5480 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location31933851-31946046 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31944621 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 166 (G166C)
Ref Sequence ENSEMBL: ENSMUSP00000057509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023460] [ENSMUST00000052174] [ENSMUST00000115178] [ENSMUST00000126215] [ENSMUST00000134666] [ENSMUST00000134928] [ENSMUST00000151412] [ENSMUST00000202722]
Predicted Effect probably benign
Transcript: ENSMUST00000023460
SMART Domains Protein: ENSMUSP00000023460
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
RRM 41 114 6.96e-23 SMART
low complexity region 122 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000052174
AA Change: G166C

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000057509
Gene: ENSMUSG00000045625
AA Change: G166C

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 7 446 1.3e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115178
SMART Domains Protein: ENSMUSP00000110832
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
PDB:3FEY|B 1 103 7e-42 PDB
Blast:RRM 41 61 2e-6 BLAST
SCOP:d1qm9a1 41 97 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126215
Predicted Effect probably benign
Transcript: ENSMUST00000134666
Predicted Effect probably benign
Transcript: ENSMUST00000134928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140965
Predicted Effect probably benign
Transcript: ENSMUST00000151412
Predicted Effect probably benign
Transcript: ENSMUST00000202722
SMART Domains Protein: ENSMUSP00000143811
Gene: ENSMUSG00000107002

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 47 55 N/A INTRINSIC
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. This gene encodes a protein that is localized to the endoplasmic reticulum, and is involved in GPI anchor biosynthesis. As shown for the yeast homolog, which is a member of a family of dolichol-phosphate-mannose (Dol-P-Man)-dependent mannosyltransferases, this protein can also add a side-branching fourth mannose to GPI precursors during the assembly of GPI anchors. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,157,999 C2257* probably null Het
Alkbh7 A G 17: 56,999,131 probably benign Het
Alpk2 A G 18: 65,349,908 L343S probably damaging Het
Btbd10 T A 7: 113,316,707 R392W probably damaging Het
Camkv A G 9: 107,946,875 D216G probably damaging Het
Col22a1 T C 15: 71,964,611 D525G probably damaging Het
Dqx1 A T 6: 83,064,803 D542V probably damaging Het
Epha8 T C 4: 136,935,130 T539A probably benign Het
Faap100 T C 11: 120,377,113 E278G probably damaging Het
Fat2 A G 11: 55,310,086 S721P probably damaging Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gfy C A 7: 45,177,233 V394F probably benign Het
Gipr A G 7: 19,160,654 L241P probably damaging Het
Gm5478 A G 15: 101,643,665 S445P probably damaging Het
Ift140 G T 17: 25,020,576 W69L probably damaging Het
Kat6a T A 8: 22,938,307 M1226K possibly damaging Het
Klk12 T G 7: 43,771,058 H140Q probably benign Het
Map3k14 A G 11: 103,239,504 F196L probably benign Het
Mblac2 T A 13: 81,750,276 V257E possibly damaging Het
Pcdha11 A G 18: 37,005,882 E188G probably benign Het
Pdzd7 T C 19: 45,039,285 N250S possibly damaging Het
Phkb A G 8: 85,922,182 D209G probably damaging Het
Pigs T G 11: 78,329,075 I92S possibly damaging Het
Pkd1l2 C A 8: 117,030,649 R1550L probably damaging Het
Pkd2l1 A G 19: 44,192,156 V40A probably benign Het
Plxna1 A T 6: 89,324,634 M1470K probably damaging Het
Polq T A 16: 37,013,290 probably benign Het
Prune2 A G 19: 17,120,947 T1272A possibly damaging Het
Rfwd3 A T 8: 111,273,832 D720E probably damaging Het
Rgs12 C G 5: 34,966,111 Q413E probably benign Het
Rhobtb1 T A 10: 69,270,733 V376D possibly damaging Het
Rrp8 C T 7: 105,734,129 S310N probably damaging Het
S100a3 C T 3: 90,602,284 L79F probably damaging Het
Setbp1 C A 18: 78,858,063 M796I probably damaging Het
Sipa1 A G 19: 5,659,630 L254P possibly damaging Het
Slc4a7 C G 14: 14,782,138 H964Q probably damaging Het
Strc G T 2: 121,364,819 P1661Q probably benign Het
Taf5l A T 8: 124,009,820 V4E possibly damaging Het
Tbc1d15 T C 10: 115,233,218 E82G probably damaging Het
Thada A G 17: 84,432,254 S858P probably benign Het
Ticrr T C 7: 79,660,809 V157A probably damaging Het
Trim21 T C 7: 102,559,256 T419A probably benign Het
Vmn2r60 G T 7: 42,135,730 W122L probably damaging Het
Vwa3b C A 1: 37,100,706 Y369* probably null Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Other mutations in Pigz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02697:Pigz APN 16 31944759 unclassified probably null
IGL02963:Pigz APN 16 31944535 missense probably damaging 0.99
R0884:Pigz UTSW 16 31941976 utr 5 prime probably null
R1252:Pigz UTSW 16 31941990 missense possibly damaging 0.49
R1776:Pigz UTSW 16 31944579 missense probably damaging 0.99
R4744:Pigz UTSW 16 31945333 missense probably damaging 1.00
R5793:Pigz UTSW 16 31945467 missense probably benign 0.00
R5905:Pigz UTSW 16 31945428 missense probably benign 0.26
R6025:Pigz UTSW 16 31945710 missense probably damaging 1.00
R6251:Pigz UTSW 16 31945606 missense possibly damaging 0.94
R6297:Pigz UTSW 16 31944937 missense probably damaging 1.00
R6735:Pigz UTSW 16 31945543 missense probably benign 0.01
R6770:Pigz UTSW 16 31945750 missense probably damaging 1.00
R6855:Pigz UTSW 16 31945218 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTGGTGAGTGGCTACATGC -3'
(R):5'- CCTGATGCCACCAAGTTCTG -3'

Sequencing Primer
(F):5'- AGTGGCTACATGCTGCTG -3'
(R):5'- CCAAGTTCTGAAGCTCTATGGATGC -3'
Posted On2016-10-06