Incidental Mutation 'R5483:Heatr1'
ID434441
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
MMRRC Submission 043044-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R5483 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12398914 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 124 (H124R)
Ref Sequence ENSEMBL: ENSMUSP00000152410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000221046] [ENSMUST00000223324]
Predicted Effect probably damaging
Transcript: ENSMUST00000059270
AA Change: H124R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: H124R

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221046
AA Change: H124R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222817
Predicted Effect probably benign
Transcript: ENSMUST00000223324
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.5%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cfap206 G T 4: 34,711,404 Q498K probably benign Het
Dnmt3a A G 12: 3,899,615 Y524C probably damaging Het
Dnttip2 A T 3: 122,276,797 T554S probably damaging Het
Emc1 A G 4: 139,375,376 T949A probably damaging Het
Enkur A T 2: 21,194,298 F142I probably benign Het
Fbxo24 C T 5: 137,618,740 A362T probably damaging Het
Hira T A 16: 18,969,540 I1011N possibly damaging Het
Ipo5 T A 14: 120,920,038 I96N probably benign Het
Kctd16 A G 18: 40,530,876 I353V probably benign Het
Klf11 T A 12: 24,655,411 L288* probably null Het
Kmt2a A T 9: 44,824,624 probably benign Het
Lmbrd1 T C 1: 24,744,908 Y373H probably damaging Het
Mlh1 G A 9: 111,231,058 A584V possibly damaging Het
Ociad1 T C 5: 73,294,971 F35S probably damaging Het
Olfr1038-ps C T 2: 86,122,618 Q232* probably null Het
Olfr323 T A 11: 58,625,957 I30F possibly damaging Het
Olfr784 T C 10: 129,387,657 I8T probably benign Het
Pkd1l1 C T 11: 8,901,141 probably null Het
Pole T A 5: 110,294,568 D287E probably damaging Het
Polh G T 17: 46,172,745 S531R probably benign Het
Prss29 A G 17: 25,322,203 K207R probably benign Het
Rasgrp3 T G 17: 75,525,018 S611R probably damaging Het
Rffl G T 11: 82,812,723 probably null Het
Scrib A G 15: 76,067,659 probably null Het
Serpinb3a T A 1: 107,047,169 K211N probably benign Het
Slc22a3 C T 17: 12,464,467 A170T probably damaging Het
Socs5 T G 17: 87,134,974 F447L probably damaging Het
Srrm2 T A 17: 23,821,272 S2393T probably damaging Het
Usp7 T A 16: 8,698,540 Y585F probably benign Het
Vps39 A T 2: 120,323,083 I670N probably benign Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
R7077:Heatr1 UTSW 13 12418164 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GGCACCTTCCAGACATGTTG -3'
(R):5'- TGACATATAGTGAGCCCCTACCC -3'

Sequencing Primer
(F):5'- CCAGACATGTTGATACACTCTTGAG -3'
(R):5'- TAGGACTTCACAGTGAGACCCTG -3'
Posted On2016-10-06