Incidental Mutation 'R5483:Scrib'
ID434443
Institutional Source Beutler Lab
Gene Symbol Scrib
Ensembl Gene ENSMUSG00000022568
Gene Namescribbled planar cell polarity
SynonymsScrb1, Crc
MMRRC Submission 043044-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5483 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76047158-76069784 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 76067659 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002599] [ENSMUST00000002603] [ENSMUST00000063747] [ENSMUST00000100527] [ENSMUST00000109946] [ENSMUST00000227316] [ENSMUST00000230924]
Predicted Effect probably benign
Transcript: ENSMUST00000002599
SMART Domains Protein: ENSMUSP00000002599
Gene: ENSMUSG00000002524

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
RRM 118 191 1.21e-22 SMART
RRM 215 288 1.6e-22 SMART
low complexity region 290 338 N/A INTRINSIC
low complexity region 400 420 N/A INTRINSIC
RRM 451 533 7.68e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000002603
SMART Domains Protein: ENSMUSP00000002603
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1306 1321 N/A INTRINSIC
coiled coil region 1390 1420 N/A INTRINSIC
low complexity region 1452 1464 N/A INTRINSIC
low complexity region 1498 1515 N/A INTRINSIC
low complexity region 1549 1560 N/A INTRINSIC
low complexity region 1648 1665 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000063747
SMART Domains Protein: ENSMUSP00000068056
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1595 1612 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100527
SMART Domains Protein: ENSMUSP00000098096
Gene: ENSMUSG00000002524

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
RRM 135 208 1.21e-22 SMART
RRM 232 305 1.6e-22 SMART
low complexity region 307 355 N/A INTRINSIC
low complexity region 417 437 N/A INTRINSIC
RRM 468 550 7.68e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109946
SMART Domains Protein: ENSMUSP00000105572
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1620 1637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136390
SMART Domains Protein: ENSMUSP00000119097
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
PDZ 27 106 2e-23 SMART
low complexity region 127 142 N/A INTRINSIC
PDZ 161 241 1.23e-23 SMART
low complexity region 246 270 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
PDZ 303 384 6.7e-25 SMART
PDZ 400 483 3.88e-21 SMART
low complexity region 611 626 N/A INTRINSIC
coiled coil region 694 724 N/A INTRINSIC
low complexity region 757 769 N/A INTRINSIC
low complexity region 803 820 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227251
Predicted Effect probably benign
Transcript: ENSMUST00000227316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229474
Predicted Effect probably benign
Transcript: ENSMUST00000230924
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.5%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified as being similar to the Drosophila scribble protein. The mammalian protein is involved in tumor suppression pathways. As a scaffold protein involved in cell polarization processes, this protein binds to many other proteins. The encoded protein binds to papillomavirus E6 protein via its PDZ domain and the C-terminus of E6. Two alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele display partial prenatal lethality. Mice homozygous for spontaneous or induced alleles exhibit craniofacial or neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cfap206 G T 4: 34,711,404 Q498K probably benign Het
Dnmt3a A G 12: 3,899,615 Y524C probably damaging Het
Dnttip2 A T 3: 122,276,797 T554S probably damaging Het
Emc1 A G 4: 139,375,376 T949A probably damaging Het
Enkur A T 2: 21,194,298 F142I probably benign Het
Fbxo24 C T 5: 137,618,740 A362T probably damaging Het
Heatr1 A G 13: 12,398,914 H124R probably damaging Het
Hira T A 16: 18,969,540 I1011N possibly damaging Het
Ipo5 T A 14: 120,920,038 I96N probably benign Het
Kctd16 A G 18: 40,530,876 I353V probably benign Het
Klf11 T A 12: 24,655,411 L288* probably null Het
Kmt2a A T 9: 44,824,624 probably benign Het
Lmbrd1 T C 1: 24,744,908 Y373H probably damaging Het
Mlh1 G A 9: 111,231,058 A584V possibly damaging Het
Ociad1 T C 5: 73,294,971 F35S probably damaging Het
Olfr1038-ps C T 2: 86,122,618 Q232* probably null Het
Olfr323 T A 11: 58,625,957 I30F possibly damaging Het
Olfr784 T C 10: 129,387,657 I8T probably benign Het
Pkd1l1 C T 11: 8,901,141 probably null Het
Pole T A 5: 110,294,568 D287E probably damaging Het
Polh G T 17: 46,172,745 S531R probably benign Het
Prss29 A G 17: 25,322,203 K207R probably benign Het
Rasgrp3 T G 17: 75,525,018 S611R probably damaging Het
Rffl G T 11: 82,812,723 probably null Het
Serpinb3a T A 1: 107,047,169 K211N probably benign Het
Slc22a3 C T 17: 12,464,467 A170T probably damaging Het
Socs5 T G 17: 87,134,974 F447L probably damaging Het
Srrm2 T A 17: 23,821,272 S2393T probably damaging Het
Usp7 T A 16: 8,698,540 Y585F probably benign Het
Vps39 A T 2: 120,323,083 I670N probably benign Het
Other mutations in Scrib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Scrib APN 15 76048794 missense possibly damaging 0.49
IGL00905:Scrib APN 15 76064990 missense probably damaging 0.96
IGL01529:Scrib APN 15 76049235 missense possibly damaging 0.66
IGL01896:Scrib APN 15 76066118 missense possibly damaging 0.75
IGL01947:Scrib APN 15 76061767 missense probably benign 0.01
IGL02219:Scrib APN 15 76065036 nonsense probably null
IGL02372:Scrib APN 15 76048255 missense probably damaging 0.99
IGL02880:Scrib APN 15 76066124 missense probably damaging 1.00
IGL02959:Scrib APN 15 76065207 missense probably damaging 0.99
R0605:Scrib UTSW 15 76067553 missense possibly damaging 0.89
R0711:Scrib UTSW 15 76066907 unclassified probably benign
R0757:Scrib UTSW 15 76062750 small deletion probably benign
R0903:Scrib UTSW 15 76066855 missense possibly damaging 0.95
R0959:Scrib UTSW 15 76051461 missense probably benign 0.34
R1483:Scrib UTSW 15 76057922 missense probably damaging 1.00
R1551:Scrib UTSW 15 76065162 missense probably damaging 1.00
R1604:Scrib UTSW 15 76048240 missense probably damaging 0.97
R1613:Scrib UTSW 15 76048542 missense probably damaging 1.00
R1615:Scrib UTSW 15 76066205 missense probably benign 0.39
R1681:Scrib UTSW 15 76064567 missense probably damaging 1.00
R3110:Scrib UTSW 15 76069374 missense probably damaging 0.98
R3112:Scrib UTSW 15 76069374 missense probably damaging 0.98
R4050:Scrib UTSW 15 76051473 missense possibly damaging 0.91
R4660:Scrib UTSW 15 76065336 missense probably damaging 0.98
R4976:Scrib UTSW 15 76051753 critical splice donor site probably null
R5119:Scrib UTSW 15 76051753 critical splice donor site probably null
R5243:Scrib UTSW 15 76065252 missense probably benign 0.00
R5246:Scrib UTSW 15 76064797 missense probably benign 0.19
R5516:Scrib UTSW 15 76062863 missense possibly damaging 0.50
R5628:Scrib UTSW 15 76049540 missense possibly damaging 0.66
R5787:Scrib UTSW 15 76059302 missense probably damaging 1.00
R5894:Scrib UTSW 15 76067732 missense probably damaging 0.99
R6005:Scrib UTSW 15 76057751 missense probably damaging 1.00
R6041:Scrib UTSW 15 76067172 missense possibly damaging 0.93
R6351:Scrib UTSW 15 76064986 missense possibly damaging 0.65
R6603:Scrib UTSW 15 76062723 missense probably benign 0.00
Z1088:Scrib UTSW 15 76048231 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACTGTGGGCTAACACTTAC -3'
(R):5'- CTGGTTTGGAAACTCTCCCATAC -3'

Sequencing Primer
(F):5'- TGTGGGCTAACACTTACCTAGACAG -3'
(R):5'- CCCATAGGGCTTTGGCTATAGAGC -3'
Posted On2016-10-06