Incidental Mutation 'R5308:Xpa'
ID434465
Institutional Source Beutler Lab
Gene Symbol Xpa
Ensembl Gene ENSMUSG00000028329
Gene Namexeroderma pigmentosum, complementation group A
SynonymsXpac
MMRRC Submission 042891-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5308 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location46155347-46196311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46185659 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 106 (E106D)
Ref Sequence ENSEMBL: ENSMUSP00000050453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030013] [ENSMUST00000058232] [ENSMUST00000132358] [ENSMUST00000142380]
Predicted Effect probably benign
Transcript: ENSMUST00000030013
AA Change: E106D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030013
Gene: ENSMUSG00000028329
AA Change: E106D

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 99 132 1.5e-20 PFAM
Pfam:XPA_C 133 185 3.7e-28 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058232
AA Change: E106D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000050453
Gene: ENSMUSG00000028329
AA Change: E106D

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 101 132 5.2e-18 PFAM
Pfam:XPA_C 134 185 3e-30 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130051
Predicted Effect probably benign
Transcript: ENSMUST00000132358
SMART Domains Protein: ENSMUSP00000138512
Gene: ENSMUSG00000028329

DomainStartEndE-ValueType
Pfam:XPA_N 1 23 1.1e-13 PFAM
Pfam:XPA_C 24 76 7.9e-29 PFAM
low complexity region 103 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141318
Predicted Effect probably benign
Transcript: ENSMUST00000142380
AA Change: E106D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121850
Gene: ENSMUSG00000028329
AA Change: E106D

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 99 132 1.5e-20 PFAM
Pfam:XPA_C 133 185 3.7e-28 PFAM
low complexity region 212 225 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.7%
  • 10x: 95.4%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein involved in DNA excision repair. The encoded protein is part of the NER (nucleotide excision repair) complext which is responsible for repair of UV radiation-induced photoproducts and DNA adducts induced by chemical carcinogens. Mutations in this gene are associated with xeroderma pigmentosum complementation group A. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mutants are highly susceptible to tumors induced by UV (skin and ocular tumors), 7,12-dimethylbenz[a]anthracene (skin tumors), benzo[a]pyrene (pulmonary tumors), 4-nitroquinoline-1-oxide (tongue tumors) and aflatoxin B(1) (liver tumors). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik T C 2: 19,524,081 D163G probably damaging Het
4931406P16Rik T A 7: 34,245,755 K355* probably null Het
Abcd4 C T 12: 84,603,293 probably null Het
Alg9 T C 9: 50,822,711 S570P possibly damaging Het
Angptl3 C A 4: 99,034,486 H255N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Cdc37 A T 9: 21,140,764 D326E probably benign Het
Cdk13 T C 13: 17,772,313 K6R probably damaging Het
Ces1b T C 8: 93,067,017 K315E probably benign Het
Cfap61 G A 2: 146,109,988 G190S probably damaging Het
Ckap4 T C 10: 84,528,374 E275G probably benign Het
Csf3r A G 4: 126,035,344 D349G probably benign Het
Cyp2d37-ps T C 15: 82,689,811 noncoding transcript Het
Dmbt1 T A 7: 131,041,021 C190S probably damaging Het
Dnah11 A G 12: 118,085,680 F1670L possibly damaging Het
Dnah5 A T 15: 28,229,651 I144F possibly damaging Het
Eno2 C A 6: 124,767,093 V84L probably damaging Het
Ercc4 G T 16: 13,130,164 R325L probably damaging Het
Fam71e1 T C 7: 44,500,182 V109A probably damaging Het
Fcgr2b T G 1: 170,965,710 Q250P probably benign Het
Gcfc2 T C 6: 81,943,543 probably null Het
Glb1l2 C T 9: 26,764,759 G509D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grn A G 11: 102,436,192 N160D possibly damaging Het
Hexdc T A 11: 121,222,269 V510D probably damaging Het
Igfbp1 G A 11: 7,199,919 probably null Het
Itga11 T A 9: 62,755,769 M589K probably benign Het
Itpr1 A T 6: 108,356,511 S51C probably damaging Het
Klra3 T C 6: 130,334,307 probably null Het
Mad2l1 T C 6: 66,537,691 probably null Het
Matn3 CGGGGCTCGGGGGC CGGGGC 12: 8,952,308 probably null Het
Myo9a T A 9: 59,863,961 Y939N probably damaging Het
Nxpe3 C T 16: 55,866,471 S58N probably benign Het
Olfr1195 T C 2: 88,683,405 E109G probably benign Het
Olfr1295 C T 2: 111,564,554 A297T probably damaging Het
Olfr345 T A 2: 36,640,694 Y218* probably null Het
Olfr402 T A 11: 74,155,571 M139K probably damaging Het
Paics T C 5: 76,956,632 S35P probably damaging Het
Pcnt A C 10: 76,356,325 Y2717* probably null Het
Pifo T C 3: 106,001,103 T107A probably benign Het
Plekho2 T A 9: 65,558,675 N144Y probably damaging Het
Plscr5 T C 9: 92,198,512 F17S possibly damaging Het
Prrc2a C T 17: 35,161,047 R192H unknown Het
Rbm27 T A 18: 42,327,210 M735K probably damaging Het
Rfc1 T A 5: 65,279,461 K625N probably damaging Het
Ric8b T A 10: 84,947,747 F156L probably benign Het
Romo1 C A 2: 156,144,553 A32E possibly damaging Het
Rpl26 T A 11: 68,904,458 Y135N probably damaging Het
Sacs T C 14: 61,192,400 V636A probably benign Het
Scyl2 A T 10: 89,642,007 I710N probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc4a1 T A 11: 102,359,077 I154F probably damaging Het
Snx11 A G 11: 96,770,709 S157P probably damaging Het
Snx18 G A 13: 113,616,847 Q517* probably null Het
Stard4 G T 18: 33,203,625 N212K probably damaging Het
Strn3 A G 12: 51,629,385 Y454H probably damaging Het
Stx17 A T 4: 48,182,851 probably benign Het
Tas2r121 G A 6: 132,700,517 T164I possibly damaging Het
Tbc1d8 T C 1: 39,389,409 Y485C probably damaging Het
Tmem45b T C 9: 31,429,084 M8V probably damaging Het
Usp28 T C 9: 49,037,201 F844L probably damaging Het
Usp32 T A 11: 85,017,718 N1054I probably benign Het
Zfp85 C T 13: 67,748,855 C366Y probably damaging Het
Other mutations in Xpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Xpa APN 4 46185606 missense probably damaging 1.00
IGL02670:Xpa APN 4 46185682 missense probably benign 0.03
R1863:Xpa UTSW 4 46155730 intron probably benign
R2149:Xpa UTSW 4 46183189 missense probably damaging 0.99
R4534:Xpa UTSW 4 46185624 missense probably benign 0.00
R6647:Xpa UTSW 4 46183089 missense probably benign 0.00
R7157:Xpa UTSW 4 46185612 missense probably damaging 1.00
R7185:Xpa UTSW 4 46183078 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCTAGAGAGAAGAGCCAG -3'
(R):5'- AACCTAAGGTTAATCAGTTTCTCCC -3'

Sequencing Primer
(F):5'- GACCCAGAAATCTCCACTTGGG -3'
(R):5'- CCCCAGTAAGCATTTGTGTCAGG -3'
Posted On2016-10-06