Incidental Mutation 'R5308:Dmbt1'
ID434480
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Namedeleted in malignant brain tumors 1
SynonymsCRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin
MMRRC Submission 042891-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R5308 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location131032053-131121630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131041021 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 190 (C190S)
Ref Sequence ENSEMBL: ENSMUSP00000148657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084509
AA Change: C75S

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: C75S

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208311
AA Change: C86S

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208860
Predicted Effect probably damaging
Transcript: ENSMUST00000213064
AA Change: C190S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.7%
  • 10x: 95.4%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik T C 2: 19,524,081 D163G probably damaging Het
4931406P16Rik T A 7: 34,245,755 K355* probably null Het
Abcd4 C T 12: 84,603,293 probably null Het
Alg9 T C 9: 50,822,711 S570P possibly damaging Het
Angptl3 C A 4: 99,034,486 H255N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Cdc37 A T 9: 21,140,764 D326E probably benign Het
Cdk13 T C 13: 17,772,313 K6R probably damaging Het
Ces1b T C 8: 93,067,017 K315E probably benign Het
Cfap61 G A 2: 146,109,988 G190S probably damaging Het
Ckap4 T C 10: 84,528,374 E275G probably benign Het
Csf3r A G 4: 126,035,344 D349G probably benign Het
Cyp2d37-ps T C 15: 82,689,811 noncoding transcript Het
Dnah11 A G 12: 118,085,680 F1670L possibly damaging Het
Dnah5 A T 15: 28,229,651 I144F possibly damaging Het
Eno2 C A 6: 124,767,093 V84L probably damaging Het
Ercc4 G T 16: 13,130,164 R325L probably damaging Het
Fam71e1 T C 7: 44,500,182 V109A probably damaging Het
Fcgr2b T G 1: 170,965,710 Q250P probably benign Het
Gcfc2 T C 6: 81,943,543 probably null Het
Glb1l2 C T 9: 26,764,759 G509D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grn A G 11: 102,436,192 N160D possibly damaging Het
Hexdc T A 11: 121,222,269 V510D probably damaging Het
Igfbp1 G A 11: 7,199,919 probably null Het
Itga11 T A 9: 62,755,769 M589K probably benign Het
Itpr1 A T 6: 108,356,511 S51C probably damaging Het
Klra3 T C 6: 130,334,307 probably null Het
Mad2l1 T C 6: 66,537,691 probably null Het
Matn3 CGGGGCTCGGGGGC CGGGGC 12: 8,952,308 probably null Het
Myo9a T A 9: 59,863,961 Y939N probably damaging Het
Nxpe3 C T 16: 55,866,471 S58N probably benign Het
Olfr1195 T C 2: 88,683,405 E109G probably benign Het
Olfr1295 C T 2: 111,564,554 A297T probably damaging Het
Olfr345 T A 2: 36,640,694 Y218* probably null Het
Olfr402 T A 11: 74,155,571 M139K probably damaging Het
Paics T C 5: 76,956,632 S35P probably damaging Het
Pcnt A C 10: 76,356,325 Y2717* probably null Het
Pifo T C 3: 106,001,103 T107A probably benign Het
Plekho2 T A 9: 65,558,675 N144Y probably damaging Het
Plscr5 T C 9: 92,198,512 F17S possibly damaging Het
Prrc2a C T 17: 35,161,047 R192H unknown Het
Rbm27 T A 18: 42,327,210 M735K probably damaging Het
Rfc1 T A 5: 65,279,461 K625N probably damaging Het
Ric8b T A 10: 84,947,747 F156L probably benign Het
Romo1 C A 2: 156,144,553 A32E possibly damaging Het
Rpl26 T A 11: 68,904,458 Y135N probably damaging Het
Sacs T C 14: 61,192,400 V636A probably benign Het
Scyl2 A T 10: 89,642,007 I710N probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc4a1 T A 11: 102,359,077 I154F probably damaging Het
Snx11 A G 11: 96,770,709 S157P probably damaging Het
Snx18 G A 13: 113,616,847 Q517* probably null Het
Stard4 G T 18: 33,203,625 N212K probably damaging Het
Strn3 A G 12: 51,629,385 Y454H probably damaging Het
Stx17 A T 4: 48,182,851 probably benign Het
Tas2r121 G A 6: 132,700,517 T164I possibly damaging Het
Tbc1d8 T C 1: 39,389,409 Y485C probably damaging Het
Tmem45b T C 9: 31,429,084 M8V probably damaging Het
Usp28 T C 9: 49,037,201 F844L probably damaging Het
Usp32 T A 11: 85,017,718 N1054I probably benign Het
Xpa T A 4: 46,185,659 E106D probably benign Het
Zfp85 C T 13: 67,748,855 C366Y probably damaging Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 131079540 intron probably benign
IGL00161:Dmbt1 APN 7 131109628 missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 131099290 missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 131082500 missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 131097607 missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 131058158 missense probably benign 0.26
IGL01072:Dmbt1 APN 7 131085368 splice site probably benign
IGL01317:Dmbt1 APN 7 131041191 missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 131088767 missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 131103679 missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 131116728 missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 131081185 missense probably benign 0.14
IGL01890:Dmbt1 APN 7 131074419 intron probably benign
IGL02160:Dmbt1 APN 7 131082688 missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 131093256 splice site probably benign
IGL02197:Dmbt1 APN 7 131085422 splice site probably benign
IGL02332:Dmbt1 APN 7 131066613 intron probably benign
IGL02427:Dmbt1 APN 7 131088085 splice site probably null
IGL02726:Dmbt1 APN 7 131074410 intron probably benign
IGL02967:Dmbt1 APN 7 131071189 missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 131082679 missense probably benign 0.05
IGL03089:Dmbt1 APN 7 131111049 missense probably damaging 0.99
H8562:Dmbt1 UTSW 7 131112076 nonsense probably null
K3955:Dmbt1 UTSW 7 131119564 missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 131106393 missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 131096049 splice site probably benign
R0427:Dmbt1 UTSW 7 131040902 nonsense probably null
R0478:Dmbt1 UTSW 7 131041187 missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 131097673 splice site probably null
R0538:Dmbt1 UTSW 7 131049901 splice site probably benign
R0626:Dmbt1 UTSW 7 131102081 missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 131097653 missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 131093117 missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 131074524 critical splice donor site probably null
R1413:Dmbt1 UTSW 7 131050214 missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 131044487 splice site probably benign
R1463:Dmbt1 UTSW 7 131109637 critical splice donor site probably null
R1509:Dmbt1 UTSW 7 131074331 intron probably benign
R1990:Dmbt1 UTSW 7 131058288 missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 131106359 missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 131099133 missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 131050018 missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 131102032 missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 131097575 missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 131046562 missense probably benign 0.03
R2256:Dmbt1 UTSW 7 131090494 missense probably benign 0.01
R2391:Dmbt1 UTSW 7 131106468 missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 131094734 nonsense probably null
R3014:Dmbt1 UTSW 7 131032097 intron probably benign
R3155:Dmbt1 UTSW 7 131050157 nonsense probably null
R3176:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3276:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3442:Dmbt1 UTSW 7 131106249 missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 131112090 missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 131074202 intron probably benign
R4396:Dmbt1 UTSW 7 131116632 missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 131040934 missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 131050012 missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 131094742 missense probably benign 0.01
R5156:Dmbt1 UTSW 7 131097670 critical splice donor site probably null
R5225:Dmbt1 UTSW 7 131094735 missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 131082619 missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 131119511 missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 131040993 missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 131063403 intron probably benign
R5526:Dmbt1 UTSW 7 131041190 missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 131099300 nonsense probably null
R5566:Dmbt1 UTSW 7 131106273 missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 131054067 missense probably benign 0.17
R6154:Dmbt1 UTSW 7 131109641 splice site probably null
R6188:Dmbt1 UTSW 7 131097631 missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 131058254 missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 131103578 missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 131116641 missense probably benign 0.01
R6603:Dmbt1 UTSW 7 131046510 intron probably null
R6719:Dmbt1 UTSW 7 131119603 missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 131046561 missense probably benign 0.16
R7148:Dmbt1 UTSW 7 131066734 nonsense probably null
R7191:Dmbt1 UTSW 7 131044520 missense unknown
R7269:Dmbt1 UTSW 7 131066621 missense unknown
R7288:Dmbt1 UTSW 7 131083789 nonsense probably null
R7296:Dmbt1 UTSW 7 131112132 missense unknown
R7349:Dmbt1 UTSW 7 131041124 missense unknown
R7386:Dmbt1 UTSW 7 131112236 missense unknown
X0024:Dmbt1 UTSW 7 131112248 nonsense probably null
X0062:Dmbt1 UTSW 7 131094851 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AAAGTTCATGAGTGAGCTGCC -3'
(R):5'- TGAACAGATGACTCCAGCATC -3'

Sequencing Primer
(F):5'- GCTGCCACCAAGTGTACAAGTG -3'
(R):5'- ATCTTCCTGGTGTCCACAGTTATGAG -3'
Posted On2016-10-06