Incidental Mutation 'R5308:Sacs'
ID434513
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
MMRRC Submission 042891-MU
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5308 (G1)
Quality Score221
Status Not validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61192400 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 636 (V636A)
Ref Sequence ENSEMBL: ENSMUSP00000086816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119509] [ENSMUST00000119943] [ENSMUST00000121091] [ENSMUST00000227570] [ENSMUST00000229692]
Predicted Effect probably benign
Transcript: ENSMUST00000089394
AA Change: V636A

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279
AA Change: V636A

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119509
AA Change: V636A

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113007
Gene: ENSMUSG00000048279
AA Change: V636A

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
SCOP:d1byqa_ 87 202 5e-3 SMART
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119943
AA Change: V636A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: V636A

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121091
AA Change: V633A

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113925
Gene: ENSMUSG00000048279
AA Change: V633A

DomainStartEndE-ValueType
SCOP:d1lm8b_ 5 63 3e-3 SMART
Blast:UBQ 6 78 4e-31 BLAST
SCOP:d1byqa_ 84 199 4e-3 SMART
Blast:HATPase_c 113 208 2e-10 BLAST
low complexity region 605 620 N/A INTRINSIC
low complexity region 661 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150222
Predicted Effect probably benign
Transcript: ENSMUST00000227570
Predicted Effect probably benign
Transcript: ENSMUST00000229692
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.7%
  • 10x: 95.4%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik T C 2: 19,524,081 D163G probably damaging Het
4931406P16Rik T A 7: 34,245,755 K355* probably null Het
Abcd4 C T 12: 84,603,293 probably null Het
Alg9 T C 9: 50,822,711 S570P possibly damaging Het
Angptl3 C A 4: 99,034,486 H255N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Cdc37 A T 9: 21,140,764 D326E probably benign Het
Cdk13 T C 13: 17,772,313 K6R probably damaging Het
Ces1b T C 8: 93,067,017 K315E probably benign Het
Cfap61 G A 2: 146,109,988 G190S probably damaging Het
Ckap4 T C 10: 84,528,374 E275G probably benign Het
Csf3r A G 4: 126,035,344 D349G probably benign Het
Cyp2d37-ps T C 15: 82,689,811 noncoding transcript Het
Dmbt1 T A 7: 131,041,021 C190S probably damaging Het
Dnah11 A G 12: 118,085,680 F1670L possibly damaging Het
Dnah5 A T 15: 28,229,651 I144F possibly damaging Het
Eno2 C A 6: 124,767,093 V84L probably damaging Het
Ercc4 G T 16: 13,130,164 R325L probably damaging Het
Fam71e1 T C 7: 44,500,182 V109A probably damaging Het
Fcgr2b T G 1: 170,965,710 Q250P probably benign Het
Gcfc2 T C 6: 81,943,543 probably null Het
Glb1l2 C T 9: 26,764,759 G509D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grn A G 11: 102,436,192 N160D possibly damaging Het
Hexdc T A 11: 121,222,269 V510D probably damaging Het
Igfbp1 G A 11: 7,199,919 probably null Het
Itga11 T A 9: 62,755,769 M589K probably benign Het
Itpr1 A T 6: 108,356,511 S51C probably damaging Het
Klra3 T C 6: 130,334,307 probably null Het
Mad2l1 T C 6: 66,537,691 probably null Het
Matn3 CGGGGCTCGGGGGC CGGGGC 12: 8,952,308 probably null Het
Myo9a T A 9: 59,863,961 Y939N probably damaging Het
Nxpe3 C T 16: 55,866,471 S58N probably benign Het
Olfr1195 T C 2: 88,683,405 E109G probably benign Het
Olfr1295 C T 2: 111,564,554 A297T probably damaging Het
Olfr345 T A 2: 36,640,694 Y218* probably null Het
Olfr402 T A 11: 74,155,571 M139K probably damaging Het
Paics T C 5: 76,956,632 S35P probably damaging Het
Pcnt A C 10: 76,356,325 Y2717* probably null Het
Pifo T C 3: 106,001,103 T107A probably benign Het
Plekho2 T A 9: 65,558,675 N144Y probably damaging Het
Plscr5 T C 9: 92,198,512 F17S possibly damaging Het
Prrc2a C T 17: 35,161,047 R192H unknown Het
Rbm27 T A 18: 42,327,210 M735K probably damaging Het
Rfc1 T A 5: 65,279,461 K625N probably damaging Het
Ric8b T A 10: 84,947,747 F156L probably benign Het
Romo1 C A 2: 156,144,553 A32E possibly damaging Het
Rpl26 T A 11: 68,904,458 Y135N probably damaging Het
Scyl2 A T 10: 89,642,007 I710N probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc4a1 T A 11: 102,359,077 I154F probably damaging Het
Snx11 A G 11: 96,770,709 S157P probably damaging Het
Snx18 G A 13: 113,616,847 Q517* probably null Het
Stard4 G T 18: 33,203,625 N212K probably damaging Het
Strn3 A G 12: 51,629,385 Y454H probably damaging Het
Stx17 A T 4: 48,182,851 probably benign Het
Tas2r121 G A 6: 132,700,517 T164I possibly damaging Het
Tbc1d8 T C 1: 39,389,409 Y485C probably damaging Het
Tmem45b T C 9: 31,429,084 M8V probably damaging Het
Usp28 T C 9: 49,037,201 F844L probably damaging Het
Usp32 T A 11: 85,017,718 N1054I probably benign Het
Xpa T A 4: 46,185,659 E106D probably benign Het
Zfp85 C T 13: 67,748,855 C366Y probably damaging Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 unclassified probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 intron probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6731:Sacs UTSW 14 61180700 intron probably null
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
R7023:Sacs UTSW 14 61208815 missense probably benign 0.04
R7047:Sacs UTSW 14 61213002 missense probably damaging 1.00
R7051:Sacs UTSW 14 61208928 missense probably benign 0.25
R7069:Sacs UTSW 14 61212496 missense probably damaging 1.00
R7082:Sacs UTSW 14 61210517 missense possibly damaging 0.94
R7108:Sacs UTSW 14 61211009 nonsense probably null
R7122:Sacs UTSW 14 61210396 missense probably damaging 1.00
R7194:Sacs UTSW 14 61210089 missense possibly damaging 0.95
R7214:Sacs UTSW 14 61191792 missense probably benign
R7221:Sacs UTSW 14 61208806 missense probably damaging 0.99
R7274:Sacs UTSW 14 61214081 missense possibly damaging 0.88
R7344:Sacs UTSW 14 61207444 missense possibly damaging 0.81
R7440:Sacs UTSW 14 61191605 missense probably benign 0.10
R7474:Sacs UTSW 14 61211178 missense probably benign 0.04
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGAAGTTTAGAATCCACGCG -3'
(R):5'- CTACTGACCGGATCAACCTTG -3'

Sequencing Primer
(F):5'- TAGAATCCACGCGATCTGTG -3'
(R):5'- TGACCGGATCAACCTTGTCTGAG -3'
Posted On2016-10-06