Incidental Mutation 'R5308:Stard4'
ID434521
Institutional Source Beutler Lab
Gene Symbol Stard4
Ensembl Gene ENSMUSG00000024378
Gene NameStAR-related lipid transfer (START) domain containing 4
Synonyms
MMRRC Submission 042891-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5308 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location33199355-33213862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33203625 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 212 (N212K)
Ref Sequence ENSEMBL: ENSMUSP00000025236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025236] [ENSMUST00000118990] [ENSMUST00000119991]
Predicted Effect probably damaging
Transcript: ENSMUST00000025236
AA Change: N212K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025236
Gene: ENSMUSG00000024378
AA Change: N212K

DomainStartEndE-ValueType
START 25 224 1.43e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118990
SMART Domains Protein: ENSMUSP00000114131
Gene: ENSMUSG00000024378

DomainStartEndE-ValueType
PDB:1JSS|B 1 110 5e-78 PDB
SCOP:d1jssa_ 24 110 3e-17 SMART
Blast:START 25 110 4e-58 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119991
SMART Domains Protein: ENSMUSP00000114109
Gene: ENSMUSG00000024378

DomainStartEndE-ValueType
PDB:1JSS|B 1 110 1e-76 PDB
SCOP:d1jssa_ 24 110 8e-17 SMART
Blast:START 25 110 8e-57 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141617
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.7%
  • 10x: 95.4%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD4 (Soccio et al., 2002 [PubMed 12011452]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased liver weight, body weight, and body length. Female mice homozygous for this allele exhibit decreased circulating cholesterol when fed a low cholesterol diet and altered bile composition when fed standard chow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik T C 2: 19,524,081 D163G probably damaging Het
4931406P16Rik T A 7: 34,245,755 K355* probably null Het
Abcd4 C T 12: 84,603,293 probably null Het
Alg9 T C 9: 50,822,711 S570P possibly damaging Het
Angptl3 C A 4: 99,034,486 H255N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Cdc37 A T 9: 21,140,764 D326E probably benign Het
Cdk13 T C 13: 17,772,313 K6R probably damaging Het
Ces1b T C 8: 93,067,017 K315E probably benign Het
Cfap61 G A 2: 146,109,988 G190S probably damaging Het
Ckap4 T C 10: 84,528,374 E275G probably benign Het
Csf3r A G 4: 126,035,344 D349G probably benign Het
Cyp2d37-ps T C 15: 82,689,811 noncoding transcript Het
Dmbt1 T A 7: 131,041,021 C190S probably damaging Het
Dnah11 A G 12: 118,085,680 F1670L possibly damaging Het
Dnah5 A T 15: 28,229,651 I144F possibly damaging Het
Eno2 C A 6: 124,767,093 V84L probably damaging Het
Ercc4 G T 16: 13,130,164 R325L probably damaging Het
Fam71e1 T C 7: 44,500,182 V109A probably damaging Het
Fcgr2b T G 1: 170,965,710 Q250P probably benign Het
Gcfc2 T C 6: 81,943,543 probably null Het
Glb1l2 C T 9: 26,764,759 G509D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grn A G 11: 102,436,192 N160D possibly damaging Het
Hexdc T A 11: 121,222,269 V510D probably damaging Het
Igfbp1 G A 11: 7,199,919 probably null Het
Itga11 T A 9: 62,755,769 M589K probably benign Het
Itpr1 A T 6: 108,356,511 S51C probably damaging Het
Klra3 T C 6: 130,334,307 probably null Het
Mad2l1 T C 6: 66,537,691 probably null Het
Matn3 CGGGGCTCGGGGGC CGGGGC 12: 8,952,308 probably null Het
Myo9a T A 9: 59,863,961 Y939N probably damaging Het
Nxpe3 C T 16: 55,866,471 S58N probably benign Het
Olfr1195 T C 2: 88,683,405 E109G probably benign Het
Olfr1295 C T 2: 111,564,554 A297T probably damaging Het
Olfr345 T A 2: 36,640,694 Y218* probably null Het
Olfr402 T A 11: 74,155,571 M139K probably damaging Het
Paics T C 5: 76,956,632 S35P probably damaging Het
Pcnt A C 10: 76,356,325 Y2717* probably null Het
Pifo T C 3: 106,001,103 T107A probably benign Het
Plekho2 T A 9: 65,558,675 N144Y probably damaging Het
Plscr5 T C 9: 92,198,512 F17S possibly damaging Het
Prrc2a C T 17: 35,161,047 R192H unknown Het
Rbm27 T A 18: 42,327,210 M735K probably damaging Het
Rfc1 T A 5: 65,279,461 K625N probably damaging Het
Ric8b T A 10: 84,947,747 F156L probably benign Het
Romo1 C A 2: 156,144,553 A32E possibly damaging Het
Rpl26 T A 11: 68,904,458 Y135N probably damaging Het
Sacs T C 14: 61,192,400 V636A probably benign Het
Scyl2 A T 10: 89,642,007 I710N probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc4a1 T A 11: 102,359,077 I154F probably damaging Het
Snx11 A G 11: 96,770,709 S157P probably damaging Het
Snx18 G A 13: 113,616,847 Q517* probably null Het
Strn3 A G 12: 51,629,385 Y454H probably damaging Het
Stx17 A T 4: 48,182,851 probably benign Het
Tas2r121 G A 6: 132,700,517 T164I possibly damaging Het
Tbc1d8 T C 1: 39,389,409 Y485C probably damaging Het
Tmem45b T C 9: 31,429,084 M8V probably damaging Het
Usp28 T C 9: 49,037,201 F844L probably damaging Het
Usp32 T A 11: 85,017,718 N1054I probably benign Het
Xpa T A 4: 46,185,659 E106D probably benign Het
Zfp85 C T 13: 67,748,855 C366Y probably damaging Het
Other mutations in Stard4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0462:Stard4 UTSW 18 33205149 missense probably damaging 1.00
R1396:Stard4 UTSW 18 33206210 missense probably damaging 0.99
R1577:Stard4 UTSW 18 33205098 missense probably damaging 1.00
R5481:Stard4 UTSW 18 33205245 missense probably benign 0.03
R6161:Stard4 UTSW 18 33209056 missense probably damaging 0.99
R6393:Stard4 UTSW 18 33205225 missense probably benign 0.00
R7062:Stard4 UTSW 18 33205534 intron probably null
R7478:Stard4 UTSW 18 33205324 missense unknown
X0065:Stard4 UTSW 18 33209072 missense probably damaging 0.98
Z1088:Stard4 UTSW 18 33203717 missense probably benign 0.01
Z1088:Stard4 UTSW 18 33203720 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTACTATGGCCCCAACAAC -3'
(R):5'- GTTTTGGGAAAATACCAGGTATTGC -3'

Sequencing Primer
(F):5'- CACCTCCAGTGTTTCCACAGG -3'
(R):5'- TTAAAACTGTCTTATAGGTGTGAGTG -3'
Posted On2016-10-06