Incidental Mutation 'R5357:Vmn2r111'
ID434561
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Namevomeronasal 2, receptor 111
SynonymsEG210876
MMRRC Submission 042936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R5357 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location22547941-22573273 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 22548102 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 805 (K805*)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
Predicted Effect probably null
Transcript: ENSMUST00000092491
AA Change: K805*
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: K805*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,152 V206A possibly damaging Het
5730522E02Rik A T 11: 25,648,148 C102* probably null Het
Brsk2 C A 7: 141,984,511 D131E possibly damaging Het
Cacng7 T C 7: 3,338,936 F112L probably benign Het
Ceacam12 T A 7: 18,077,459 C282* probably null Het
Dnm1 T C 2: 32,336,241 D312G probably null Het
Dyrk1b T C 7: 28,185,318 V326A possibly damaging Het
Eloa T C 4: 136,009,248 D563G probably benign Het
Evi5l A G 8: 4,203,623 K489R possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Galntl6 T C 8: 57,884,463 E326G probably damaging Het
Gm1758 G A 16: 14,502,354 noncoding transcript Het
Grm8 A T 6: 27,762,419 L269Q probably damaging Het
Hsd17b12 A G 2: 94,033,645 I284T possibly damaging Het
Hyal6 T A 6: 24,734,518 M150K probably benign Het
Ift80 T A 3: 68,990,780 Q74L possibly damaging Het
Krt76 T C 15: 101,887,385 K450R probably benign Het
Larp1b A G 3: 41,024,515 E2G probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Map2k7 A T 8: 4,244,461 H253L probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mmp2 A G 8: 92,833,152 T248A possibly damaging Het
Mt1 T A 8: 94,180,104 C33S probably damaging Het
Obox5 T A 7: 15,757,538 M1K probably null Het
Pak4 A G 7: 28,564,406 S302P probably damaging Het
Pcsk2 T C 2: 143,573,464 Y66H probably benign Het
Pgm3 G A 9: 86,556,257 R451* probably null Het
Phf10 A T 17: 14,954,013 probably null Het
Pkd1 T G 17: 24,565,790 V402G probably damaging Het
Plekha4 G T 7: 45,534,771 V61F probably damaging Het
Ppfia2 G A 10: 106,904,847 probably null Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Skil A G 3: 31,113,551 H444R probably benign Het
Tcn2 T G 11: 3,926,017 D137A possibly damaging Het
Tnks2 G A 19: 36,849,290 silent Het
Trh T A 6: 92,242,834 D167V probably benign Het
Tshz1 C T 18: 84,015,080 G401D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl T A 7: 104,148,931 Q453L probably damaging Het
Wnt16 T G 6: 22,291,232 probably benign Het
Zc3h11a A T 1: 133,623,042 V665E probably damaging Het
Zfp456 A T 13: 67,372,209 M63K possibly damaging Het
Zzef1 C T 11: 72,843,333 Q584* probably null Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTTAGAGGAAACAGTGAGAGTTATTC -3'
(R):5'- ACTCTATTCTGGGATACTTGGC -3'

Sequencing Primer
(F):5'- AACAGTGAGAGTTATTCTAAAACCAG -3'
(R):5'- GGGATACTTGGCTCTCCTGTC -3'
Posted On2016-10-06