Incidental Mutation 'R5451:Lingo1'
ID434588
Institutional Source Beutler Lab
Gene Symbol Lingo1
Ensembl Gene ENSMUSG00000049556
Gene Nameleucine rich repeat and Ig domain containing 1
SynonymsLINGO-1, LERN1, Lrrn6a, UNQ201, 4930471K13Rik
MMRRC Submission 043016-MU
Accession Numbers

Genbank: NM_181074; MGI: 1915522

Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R5451 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56618475-56796468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 56620427 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 293 (I293L)
Ref Sequence ENSEMBL: ENSMUSP00000148179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053568] [ENSMUST00000114247] [ENSMUST00000114256] [ENSMUST00000210032]
Predicted Effect probably damaging
Transcript: ENSMUST00000053568
AA Change: I293L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059050
Gene: ENSMUSG00000049556
AA Change: I293L

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
LRRNT 35 69 1.6e-3 SMART
LRR 88 111 6.22e0 SMART
LRR_TYP 112 135 5.81e-2 SMART
LRR 136 159 6.57e-1 SMART
LRR 160 183 3.02e0 SMART
LRR 184 207 1.51e0 SMART
LRR 208 231 1.81e2 SMART
LRR 280 303 8.26e1 SMART
LRR 304 327 9.24e1 SMART
LRR 328 351 1.43e-1 SMART
LRRCT 363 416 4.15e-2 SMART
IGc2 431 498 1.58e-10 SMART
transmembrane domain 554 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114247
AA Change: I293L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109885
Gene: ENSMUSG00000049556
AA Change: I293L

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
LRRNT 35 69 1.6e-3 SMART
LRR 88 111 6.22e0 SMART
LRR_TYP 112 135 5.81e-2 SMART
LRR 136 159 6.57e-1 SMART
LRR 160 183 3.02e0 SMART
LRR 184 207 1.51e0 SMART
LRR 208 231 1.81e2 SMART
LRR 280 303 8.26e1 SMART
LRR 304 327 9.24e1 SMART
LRR 328 351 1.43e-1 SMART
LRRCT 363 416 4.15e-2 SMART
IGc2 431 498 1.58e-10 SMART
transmembrane domain 554 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114256
AA Change: I299L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109894
Gene: ENSMUSG00000049556
AA Change: I299L

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
LRRNT 41 75 1.6e-3 SMART
LRR 94 117 6.22e0 SMART
LRR_TYP 118 141 5.81e-2 SMART
LRR 142 165 6.57e-1 SMART
LRR 166 189 3.02e0 SMART
LRR 190 213 1.51e0 SMART
LRR 214 237 1.81e2 SMART
LRR 286 309 8.26e1 SMART
LRR 310 333 9.24e1 SMART
LRR 334 357 1.43e-1 SMART
LRRCT 369 422 4.15e-2 SMART
IGc2 437 504 1.58e-10 SMART
transmembrane domain 560 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210032
AA Change: I293L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early-onset CNS myelination. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A G 6: 73,468,867 V233A probably benign Het
Abca12 A G 1: 71,294,917 F1142S possibly damaging Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Calhm2 T A 19: 47,132,875 Y285F possibly damaging Het
Casr T C 16: 36,509,908 T355A probably damaging Het
Clca1 T C 3: 145,027,986 Y63C probably damaging Het
Cntnap5a T C 1: 115,685,143 S3P probably benign Het
Col27a1 G A 4: 63,225,239 G388D probably damaging Het
Cwh43 T C 5: 73,431,913 M447T probably benign Het
Dnah7b G A 1: 46,242,019 G2747S possibly damaging Het
Fam58b T A 11: 78,751,289 Q125L possibly damaging Het
Fbxo7 A G 10: 86,029,037 S51G probably benign Het
Gabbr2 T A 4: 46,684,294 Y660F probably benign Het
Galnt15 A G 14: 32,029,911 E140G probably benign Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm21964 A T 8: 110,109,871 I160F probably damaging Het
Gsap T A 5: 21,217,447 L138Q probably damaging Het
Igflr1 A G 7: 30,566,322 N57S possibly damaging Het
Ighv13-2 A G 12: 114,357,853 F89L probably damaging Het
Irf2bpl A G 12: 86,882,072 V609A probably benign Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lsm2 T C 17: 34,982,209 probably benign Het
Map4 C T 9: 110,037,783 probably benign Het
Micall1 T A 15: 79,126,904 probably null Het
Mpp7 T C 18: 7,442,855 D156G probably null Het
Mybbp1a A G 11: 72,448,113 D822G probably damaging Het
Naip2 A G 13: 100,188,860 V180A probably benign Het
Nol10 T A 12: 17,359,102 Y159* probably null Het
Nphp3 A G 9: 104,042,022 T1290A probably benign Het
Olfr1107 T C 2: 87,071,997 I46V probably damaging Het
Olfr1112 T A 2: 87,192,452 V255E probably damaging Het
Olfr835 T C 9: 19,035,491 Y123H probably damaging Het
Pcsk5 T A 19: 17,463,356 Y1290F possibly damaging Het
Rab42 T C 4: 132,302,516 N132D probably benign Het
Rfx3 T G 19: 27,849,959 T76P probably damaging Het
Rps13-ps2 G T 7: 88,530,828 noncoding transcript Het
Slc12a3 A G 8: 94,357,027 D894G possibly damaging Het
Slc25a15 G A 8: 22,389,967 T54I probably benign Het
Slco1c1 A T 6: 141,559,878 Q461L probably benign Het
Slfn5 T G 11: 82,960,086 I403R probably damaging Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
Tbc1d32 T A 10: 56,195,475 T318S possibly damaging Het
Tiam2 G T 17: 3,428,996 R668M probably damaging Het
Trgj4 G T 13: 19,342,165 probably benign Het
Trim9 A G 12: 70,346,829 S114P probably benign Het
Trp53i11 T C 2: 93,199,855 L169P possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r190-ps A G 13: 22,144,731 noncoding transcript Het
Other mutations in Lingo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Lingo1 APN 9 56619827 missense probably damaging 1.00
IGL02335:Lingo1 APN 9 56620081 missense probably damaging 1.00
IGL03093:Lingo1 APN 9 56619464 missense possibly damaging 0.90
3-1:Lingo1 UTSW 9 56620420 missense probably benign 0.02
R1840:Lingo1 UTSW 9 56620558 missense probably benign 0.38
R1932:Lingo1 UTSW 9 56619650 missense possibly damaging 0.89
R2475:Lingo1 UTSW 9 56619626 missense probably benign 0.03
R3439:Lingo1 UTSW 9 56620733 missense probably benign 0.23
R3870:Lingo1 UTSW 9 56619725 missense probably benign 0.00
R4241:Lingo1 UTSW 9 56620102 missense probably damaging 1.00
R4701:Lingo1 UTSW 9 56620258 missense probably damaging 1.00
R4757:Lingo1 UTSW 9 56619925 missense probably benign 0.14
R6190:Lingo1 UTSW 9 56619650 missense possibly damaging 0.89
R6254:Lingo1 UTSW 9 56620087 missense possibly damaging 0.55
R6836:Lingo1 UTSW 9 56619772 missense probably damaging 0.99
R6849:Lingo1 UTSW 9 56619616 missense probably damaging 1.00
R6935:Lingo1 UTSW 9 56619865 missense probably damaging 1.00
R7051:Lingo1 UTSW 9 56620183 missense probably benign 0.35
R7116:Lingo1 UTSW 9 56620627 missense probably benign 0.17
R7196:Lingo1 UTSW 9 56620619 missense probably damaging 1.00
X0023:Lingo1 UTSW 9 56620028 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGGAAGGCTGACTCCTCCAG -3'
(R):5'- GCGGCTACGACATCTCAACATC -3'

Sequencing Primer
(F):5'- TGACTCCTCCAGGGTGGTCAG -3'
(R):5'- CTTCAAGAGGCTGTACCGACTTAAG -3'
Posted On2016-10-06