Incidental Mutation 'R4890:Chsy1'
ID434635
Institutional Source Beutler Lab
Gene Symbol Chsy1
Ensembl Gene ENSMUSG00000032640
Gene Namechondroitin sulfate synthase 1
Synonyms
MMRRC Submission 042495-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4890 (G1)
Quality Score186
Status Validated
Chromosome7
Chromosomal Location66109515-66173798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66110226 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 106 (R106G)
Ref Sequence ENSEMBL: ENSMUSP00000047487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036372]
Predicted Effect probably benign
Transcript: ENSMUST00000036372
AA Change: R106G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047487
Gene: ENSMUSG00000032640
AA Change: R106G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Fringe 81 307 3.8e-21 PFAM
Pfam:CHGN 237 776 9.8e-197 PFAM
Pfam:Glyco_tranf_2_2 548 751 1.2e-10 PFAM
Pfam:Glyco_transf_7C 674 747 2.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181911
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. These enzymes possess dual glucuronyltransferase and galactosaminyltransferase activity and play critical roles in the biosynthesis of chondroitin sulfate, a glycosaminoglycan involved in many biological processes including cell proliferation and morphogenesis. Decreased expression of this gene may play a role in colorectal cancer, and mutations in this gene are a cause of temtamy preaxial brachydactyly syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mice are viable, but display chondrodysplasia, brachydactyly and decreased bone density. Retinal degeneration, impaired motor strength, and hematological abnormalities are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,587 S87T possibly damaging Het
AA986860 T C 1: 130,740,988 probably benign Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgrb3 T C 1: 25,221,827 N916S probably damaging Het
AI464131 G A 4: 41,498,877 T251M probably benign Het
Aox2 T C 1: 58,334,703 V841A probably benign Het
Baz2b A T 2: 59,926,039 M983K probably damaging Het
BC027072 C T 17: 71,752,311 V124I possibly damaging Het
C2cd2l A G 9: 44,311,133 F682L probably damaging Het
Ccsap T G 8: 123,845,421 E114A possibly damaging Het
Cept1 T A 3: 106,505,807 T201S probably damaging Het
Cfap221 T C 1: 119,955,746 M232V probably benign Het
Cit C T 5: 115,988,123 probably benign Het
Cldn7 G A 11: 69,967,092 V42I probably benign Het
Cnnm4 T A 1: 36,472,264 V191E probably benign Het
Cntf A T 19: 12,763,962 V178D possibly damaging Het
Ctsz C A 2: 174,428,600 R263L probably damaging Het
Dclk1 T C 3: 55,521,932 M407T probably benign Het
Dennd1a A T 2: 38,176,226 probably benign Het
Dnhd1 A G 7: 105,656,957 I368V possibly damaging Het
Fam159a A G 4: 108,367,801 V188A probably benign Het
Gak A T 5: 108,580,876 probably benign Het
Gm12794 A G 4: 101,941,591 E253G probably damaging Het
Gm9268 A G 7: 43,047,600 R687G probably damaging Het
Hepacam2 A T 6: 3,487,231 V42D probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Insr T A 8: 3,198,234 Q437L probably benign Het
Itga8 G A 2: 12,193,291 probably benign Het
Kansl1 A T 11: 104,343,042 C732S probably benign Het
Kdsr T C 1: 106,753,234 K78R probably benign Het
Kif14 T C 1: 136,487,130 S785P possibly damaging Het
Lbr C A 1: 181,817,568 L506F probably benign Het
Macf1 C A 4: 123,448,238 C2720F probably damaging Het
Mapt G A 11: 104,328,149 D738N probably damaging Het
Mroh9 T C 1: 163,026,524 Y769C probably damaging Het
Mylk2 A G 2: 152,920,354 N515S possibly damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nrxn2 A T 19: 6,448,278 S258C possibly damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1346 T A 7: 6,474,849 C246* probably null Het
Olfr672 G A 7: 104,996,104 H267Y probably benign Het
Olfr786 C T 10: 129,437,079 T89I probably benign Het
Olfr893 G T 9: 38,209,290 C79F probably benign Het
Osgin2 G A 4: 16,013,739 probably benign Het
Otud3 G A 4: 138,913,749 R27W probably damaging Het
Pcdhga12 T A 18: 37,768,237 F707L possibly damaging Het
Pik3r1 T C 13: 101,757,610 E17G probably damaging Het
Prickle4 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 17: 47,689,881 probably benign Het
Prokr1 G A 6: 87,588,696 R56W probably benign Het
Ptprz1 G A 6: 23,024,958 C1731Y probably damaging Het
Rbm15b A T 9: 106,885,829 F380Y possibly damaging Het
Rfc5 G A 5: 117,386,820 L56F probably damaging Het
Rhpn2 A T 7: 35,390,803 M617L probably benign Het
Rusc1 T C 3: 89,088,270 probably null Het
Sec23ip A G 7: 128,752,910 N297D probably damaging Het
Sema3c A T 5: 17,675,159 H259L probably benign Het
Sgsm1 G A 5: 113,280,462 probably benign Het
Sipa1l2 T A 8: 125,491,867 S244C probably damaging Het
Slc39a5 T C 10: 128,398,447 I196V probably benign Het
Smim22 G A 16: 5,007,858 A36T probably damaging Het
Spag6 A G 2: 18,742,777 I408V probably benign Het
Sult2a5 A G 7: 13,625,386 I96V probably benign Het
Tmcc2 C A 1: 132,380,779 A126S probably benign Het
Tsc2 A T 17: 24,600,035 S1276T probably damaging Het
Ttc21a A G 9: 119,959,037 S843G probably benign Het
Tubd1 G C 11: 86,552,795 V110L possibly damaging Het
Ugt1a2 T A 1: 88,200,812 V59D probably damaging Het
Vsig8 T A 1: 172,561,575 H131Q probably benign Het
Zbtb42 C A 12: 112,680,427 Y345* probably null Het
Zfp612 T A 8: 110,089,944 C594* probably null Het
Zfp940 A G 7: 29,845,399 V361A probably benign Het
Other mutations in Chsy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Chsy1 APN 7 66172126 missense possibly damaging 0.70
IGL01734:Chsy1 APN 7 66171310 missense probably damaging 0.98
IGL02037:Chsy1 APN 7 66171828 missense possibly damaging 0.69
IGL02797:Chsy1 APN 7 66171664 missense probably damaging 1.00
IGL02961:Chsy1 APN 7 66171782 missense probably benign 0.00
IGL03290:Chsy1 APN 7 66171031 missense probably benign 0.15
IGL03292:Chsy1 APN 7 66125372 missense probably benign 0.02
deprimido UTSW 7 66171687 missense probably damaging 1.00
Elevado UTSW 7 66110076 nonsense probably null
R0669:Chsy1 UTSW 7 66171687 missense probably damaging 1.00
R1336:Chsy1 UTSW 7 66125239 splice site probably null
R1499:Chsy1 UTSW 7 66172002 missense probably damaging 1.00
R1640:Chsy1 UTSW 7 66171514 missense probably benign 0.34
R1674:Chsy1 UTSW 7 66171663 missense probably damaging 1.00
R1812:Chsy1 UTSW 7 66171817 missense probably benign 0.12
R1934:Chsy1 UTSW 7 66172243 missense probably damaging 1.00
R2964:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R2965:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R2966:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R3692:Chsy1 UTSW 7 66171253 missense probably damaging 1.00
R5373:Chsy1 UTSW 7 66110076 nonsense probably null
R5936:Chsy1 UTSW 7 66172277 missense possibly damaging 0.89
R6149:Chsy1 UTSW 7 66125385 missense probably damaging 1.00
R6192:Chsy1 UTSW 7 66170877 missense probably benign 0.29
R6653:Chsy1 UTSW 7 66110193 missense probably benign 0.10
R6848:Chsy1 UTSW 7 66171037 missense probably damaging 1.00
R7318:Chsy1 UTSW 7 66110229 critical splice donor site probably null
X0012:Chsy1 UTSW 7 66172168 missense probably damaging 1.00
X0063:Chsy1 UTSW 7 66171924 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCATGGTCCCCTCTTAAAGG -3'
(R):5'- ATCCCAAAGCCTTGCCCTTG -3'

Sequencing Primer
(F):5'- CTGGCTCAGCATGCTGC -3'
(R):5'- CAAAGCCTTGCCCTTGAGAGATG -3'
Posted On2016-10-14