Incidental Mutation 'R4909:Cpeb3'
ID434650
Institutional Source Beutler Lab
Gene Symbol Cpeb3
Ensembl Gene ENSMUSG00000039652
Gene Namecytoplasmic polyadenylation element binding protein 3
Synonyms4831444O18Rik
MMRRC Submission 042511-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R4909 (G1)
Quality Score74
Status Validated
Chromosome19
Chromosomal Location37021291-37208601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37174233 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 248 (S248G)
Ref Sequence ENSEMBL: ENSMUSP00000120416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079754] [ENSMUST00000123727] [ENSMUST00000124158] [ENSMUST00000126188] [ENSMUST00000126781] [ENSMUST00000128642] [ENSMUST00000131917] [ENSMUST00000132580] [ENSMUST00000133988] [ENSMUST00000136286] [ENSMUST00000142973] [ENSMUST00000154376]
Predicted Effect probably benign
Transcript: ENSMUST00000079754
AA Change: S248G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078690
Gene: ENSMUSG00000039652
AA Change: S248G

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000123727
AA Change: S248G

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121987
Gene: ENSMUSG00000039652
AA Change: S248G

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
RRM 429 501 2.01e-5 SMART
RRM 537 610 1e-2 SMART
PDB:2M13|A 611 676 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124158
SMART Domains Protein: ENSMUSP00000115656
Gene: ENSMUSG00000039652

DomainStartEndE-ValueType
RRM 159 231 2.01e-5 SMART
RRM 267 340 1e-2 SMART
PDB:2M13|A 341 406 6e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000126188
AA Change: S248G

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120416
Gene: ENSMUSG00000039652
AA Change: S248G

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RRM 437 509 2.01e-5 SMART
RRM 545 618 1e-2 SMART
PDB:2M13|A 619 684 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000126781
AA Change: S248G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122442
Gene: ENSMUSG00000039652
AA Change: S248G

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RRM 437 509 8.3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128642
SMART Domains Protein: ENSMUSP00000115038
Gene: ENSMUSG00000039652

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131917
SMART Domains Protein: ENSMUSP00000123080
Gene: ENSMUSG00000039652

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132580
AA Change: S248G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118723
Gene: ENSMUSG00000039652
AA Change: S248G

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133988
SMART Domains Protein: ENSMUSP00000116749
Gene: ENSMUSG00000039652

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 162 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136286
AA Change: S248G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116309
Gene: ENSMUSG00000039652
AA Change: S248G

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
RRM 443 515 2.01e-5 SMART
RRM 551 624 1e-2 SMART
PDB:2M13|A 625 690 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000142973
SMART Domains Protein: ENSMUSP00000117242
Gene: ENSMUSG00000039652

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154376
AA Change: S248G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116172
Gene: ENSMUSG00000039652
AA Change: S248G

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180609
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (101/104)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, increased anxiety-related response, enhanced contextual conditioning behavior, abnormal spatial reference memory, hypoactivity and abnormal hippocampus pyramidal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik A T 12: 20,815,088 noncoding transcript Het
A830010M20Rik C T 5: 107,507,310 Q992* probably null Het
Aars G A 8: 111,055,083 G929D probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Actn4 A T 7: 28,898,657 L506Q probably damaging Het
Adam26a A T 8: 43,570,438 F5Y probably benign Het
Adamts5 G A 16: 85,900,066 Q68* probably null Het
Adcy9 A G 16: 4,298,754 I871T probably benign Het
Ak5 A T 3: 152,655,877 L136H probably damaging Het
Ap1g2 A G 14: 55,105,026 probably null Het
Ap2a1 G A 7: 44,906,381 T355M probably damaging Het
Ap3s2 T C 7: 79,915,241 D60G possibly damaging Het
Apold1 G A 6: 134,983,595 R4Q probably benign Het
Atp13a5 G T 16: 29,334,028 Q207K possibly damaging Het
BC035947 A C 1: 78,498,029 I622S probably damaging Het
Bmper G T 9: 23,377,725 V339F probably benign Het
C1ra A G 6: 124,522,334 D493G probably damaging Het
C3 C T 17: 57,226,830 probably null Het
Cabp4 T A 19: 4,137,121 I209F possibly damaging Het
Cacna1s A T 1: 136,079,604 H453L probably damaging Het
Camk2g A G 14: 20,792,584 V32A probably benign Het
Ccdc175 G A 12: 72,159,753 R240C probably damaging Het
Cdk13 C T 13: 17,772,403 S590N possibly damaging Het
Cfap45 A T 1: 172,529,876 T24S probably benign Het
Clca1 T G 3: 145,024,563 K174Q probably damaging Het
Col1a2 G A 6: 4,529,058 probably benign Het
Colgalt1 A T 8: 71,620,633 I323F possibly damaging Het
Ctcfl C T 2: 173,095,398 A576T probably benign Het
Cyp4f16 T G 17: 32,550,321 V395G possibly damaging Het
Dchs1 C T 7: 105,766,255 G605S probably damaging Het
Egflam A T 15: 7,219,629 F903I probably damaging Het
Eif5a G A 11: 69,917,485 A62V possibly damaging Het
Fam217a A G 13: 34,910,406 S609P probably damaging Het
Fhad1 T A 4: 141,985,511 I206F probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fras1 T A 5: 96,708,758 M2000K probably benign Het
Frmd5 C T 2: 121,591,653 probably null Het
Gle1 T C 2: 29,936,080 L57P probably benign Het
Glrx3 C A 7: 137,445,036 N52K probably damaging Het
Grin3b A G 10: 79,977,104 *1004W probably null Het
Hectd4 T A 5: 121,263,891 F347L probably benign Het
Htra1 G A 7: 130,985,072 V462I probably benign Het
Itga11 A G 9: 62,755,299 Y518C probably damaging Het
Krtap15 T C 16: 88,829,365 F88L probably benign Het
Ktn1 A T 14: 47,706,460 R866W probably damaging Het
Lamb1 G A 12: 31,288,281 R483H probably damaging Het
Megf6 C T 4: 154,265,391 R983C probably damaging Het
Mybpc3 T A 2: 91,134,812 D1075E probably benign Het
Myo7b A T 18: 31,964,436 N1792K probably benign Het
Nabp2 A T 10: 128,401,687 probably benign Het
Neil3 A G 8: 53,638,893 C7R probably damaging Het
Nxpe2 T A 9: 48,319,597 I491F possibly damaging Het
Obscn A G 11: 59,061,465 V4292A possibly damaging Het
Ogfod3 A G 11: 121,197,492 S139P probably damaging Het
Olfr374 A G 8: 72,109,581 N5S probably damaging Het
Olfr418 A T 1: 173,270,979 D268V probably damaging Het
Olfr682-ps1 C A 7: 105,128,228 V70L probably benign Het
Olfr800 A G 10: 129,660,720 I305V probably benign Het
Oog2 T C 4: 144,195,099 I211T possibly damaging Het
Oosp1 T C 19: 11,688,716 D70G probably benign Het
Padi3 T C 4: 140,795,626 D345G probably damaging Het
Pcyt2 A G 11: 120,615,420 F71L probably benign Het
Pi4k2b T C 5: 52,754,629 probably benign Het
Pigr A C 1: 130,848,458 T577P possibly damaging Het
Pirb G A 7: 3,719,362 Q161* probably null Het
Pnlip A G 19: 58,676,240 E204G possibly damaging Het
Pop7 G T 5: 137,501,899 D57E probably benign Het
Ppfia4 A T 1: 134,332,501 I8N probably damaging Het
Pprc1 A G 19: 46,064,319 T759A probably damaging Het
Prom1 T C 5: 44,045,552 N213S probably benign Het
Prop1 GCTTCACT GCTTCACTTCACT 11: 50,952,036 probably null Het
Prop1 A T 11: 50,952,045 L105H probably damaging Het
Pwp2 A T 10: 78,182,494 M121K possibly damaging Het
Rap1gds1 A T 3: 138,983,748 M161K possibly damaging Het
Rps6kb2 T A 19: 4,157,003 probably benign Het
Rxfp1 A G 3: 79,644,802 S731P probably benign Het
Scfd1 T C 12: 51,390,412 V137A probably benign Het
Slc6a15 G A 10: 103,404,414 D333N probably damaging Het
Sqor T C 2: 122,785,181 V74A possibly damaging Het
Stil T A 4: 115,024,225 Y655* probably null Het
Syt14 A T 1: 192,898,859 I468K probably damaging Het
Tbc1d31 T C 15: 57,962,265 probably null Het
Tspyl5 A T 15: 33,686,849 S317T probably damaging Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttf2 T C 3: 100,954,315 T620A probably damaging Het
Usp32 G A 11: 85,055,772 Q269* probably null Het
Vsig10 T A 5: 117,338,243 V254E probably benign Het
Wdr6 C T 9: 108,572,988 A1114T probably benign Het
Zfp280d A G 9: 72,331,432 S63G probably damaging Het
Zfp607b A G 7: 27,703,796 D559G probably benign Het
Zfp934 T C 13: 62,517,954 H291R probably damaging Het
Other mutations in Cpeb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Cpeb3 APN 19 37054295 missense probably damaging 1.00
IGL01402:Cpeb3 APN 19 37088548 missense probably benign 0.01
IGL01404:Cpeb3 APN 19 37088548 missense probably benign 0.01
IGL01702:Cpeb3 APN 19 37126382 missense possibly damaging 0.85
IGL01811:Cpeb3 APN 19 37044608 missense probably damaging 1.00
IGL03036:Cpeb3 APN 19 37024948 missense probably damaging 1.00
R0580:Cpeb3 UTSW 19 37174035 missense probably benign 0.02
R1463:Cpeb3 UTSW 19 37139100 missense probably benign 0.08
R1572:Cpeb3 UTSW 19 37139082 missense probably benign 0.38
R1914:Cpeb3 UTSW 19 37054265 missense probably damaging 1.00
R1915:Cpeb3 UTSW 19 37054265 missense probably damaging 1.00
R2031:Cpeb3 UTSW 19 37044679 missense probably damaging 1.00
R4296:Cpeb3 UTSW 19 37173989 missense possibly damaging 0.90
R4528:Cpeb3 UTSW 19 37139088 missense possibly damaging 0.85
R4607:Cpeb3 UTSW 19 37174839 missense possibly damaging 0.82
R4909:Cpeb3 UTSW 19 37174659 missense probably damaging 1.00
R5240:Cpeb3 UTSW 19 37174515 missense probably damaging 0.99
R5985:Cpeb3 UTSW 19 37087552 missense probably damaging 1.00
R6179:Cpeb3 UTSW 19 37088453 missense probably damaging 1.00
R6309:Cpeb3 UTSW 19 37044689 missense possibly damaging 0.87
R6768:Cpeb3 UTSW 19 37025032 missense possibly damaging 0.92
R6787:Cpeb3 UTSW 19 37044689 missense possibly damaging 0.87
R7102:Cpeb3 UTSW 19 37174719 missense not run
Predicted Primers PCR Primer
(F):5'- ATCCTCCATCCAGGACTTGG -3'
(R):5'- TCAACGGGACCATGCTCTTC -3'

Sequencing Primer
(F):5'- CTGCACGAGGGAACTTGG -3'
(R):5'- GGGACCATGCTCTTCCAAAACTTC -3'
Posted On2016-10-20