Incidental Mutation 'R4835:Ruvbl1'
ID434654
Institutional Source Beutler Lab
Gene Symbol Ruvbl1
Ensembl Gene ENSMUSG00000030079
Gene NameRuvB-like protein 1
SynonymsTip49a, 2510009G06Rik, Pontin52
MMRRC Submission 042450-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R4835 (G1)
Quality Score190
Status Validated
Chromosome6
Chromosomal Location88465409-88497572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88497229 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 405 (Y405H)
Ref Sequence ENSEMBL: ENSMUSP00000032165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032165]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032165
AA Change: Y405H

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032165
Gene: ENSMUSG00000030079
AA Change: Y405H

DomainStartEndE-ValueType
AAA 62 365 1.51e-11 SMART
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has both DNA-dependent ATPase and DNA helicase activities and belongs to the ATPases associated with diverse cellular activities (AAA+) protein family. The encoded protein associates with several multisubunit transcriptional complexes and with protein complexes involved in both ATP-dependent remodeling and histone modification. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele show impaired proliferation of the pluripotent inner mass cells and embryonic lethality before implantation. Conditional ablation of this gene in hematopoietic tissues leads to bone marrow failure involving apoptotic loss of hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,574,901 noncoding transcript Het
4933434E20Rik A G 3: 90,063,209 N17D probably benign Het
A1bg T C 15: 60,920,251 D176G probably benign Het
Abcg5 A T 17: 84,658,648 M428K possibly damaging Het
Adam1a A T 5: 121,519,689 C514S probably damaging Het
Angptl3 A G 4: 99,037,412 Q325R probably benign Het
Ankrd26 C T 6: 118,548,850 W378* probably null Het
Apob T C 12: 8,015,391 V4087A possibly damaging Het
Auts2 A G 5: 131,466,093 I117T probably damaging Het
AW146154 T A 7: 41,480,468 E408V probably damaging Het
Bicd1 A T 6: 149,484,090 N107I probably benign Het
Blm T C 7: 80,509,546 S281G probably benign Het
Btaf1 T A 19: 37,002,458 D1542E probably benign Het
C2cd2l A G 9: 44,315,145 probably null Het
Capn8 C A 1: 182,604,551 N362K probably damaging Het
Ccdc14 T G 16: 34,705,038 S186A probably damaging Het
Cdca4 A G 12: 112,821,547 L187P probably damaging Het
Chil6 T A 3: 106,405,974 K20* probably null Het
Cmss1 A T 16: 57,316,182 L109* probably null Het
Cmtm6 G T 9: 114,731,342 W36L probably benign Het
Cnksr3 T G 10: 7,160,757 I35L possibly damaging Het
Col4a2 G T 8: 11,423,570 G534* probably null Het
Col5a1 T G 2: 28,025,644 V180G probably damaging Het
Ctnna3 T C 10: 63,581,944 F154L probably benign Het
Fabp7 G A 10: 57,785,580 V50M possibly damaging Het
Fam170a T A 18: 50,281,983 V232D probably damaging Het
Fam186a T G 15: 99,945,808 T852P unknown Het
Fam20a T C 11: 109,673,563 I455V probably benign Het
Fbxl6 C T 15: 76,536,804 V324M probably damaging Het
Galnt18 T C 7: 111,779,523 T9A probably damaging Het
Golgb1 T A 16: 36,891,407 M191K possibly damaging Het
Gpld1 A G 13: 24,982,716 T650A probably benign Het
Gprc5d A G 6: 135,116,517 F131L probably benign Het
H2afv C T 11: 6,439,437 G7E unknown Het
Haus4 A T 14: 54,545,835 probably null Het
Helq A G 5: 100,774,163 I725T possibly damaging Het
Igsf23 T A 7: 19,941,830 D117V possibly damaging Het
Kiz A T 2: 146,942,088 S514C probably damaging Het
Klhl6 A T 16: 19,957,033 N258K probably benign Het
Krt72 G C 15: 101,781,073 probably null Het
Large1 A T 8: 73,048,347 I245N probably damaging Het
Lrrc31 T C 3: 30,679,157 I469M probably damaging Het
Lypd4 T A 7: 24,866,696 I68F probably benign Het
Mast1 A G 8: 84,923,779 S442P probably damaging Het
Mmp20 T A 9: 7,645,299 H283Q probably benign Het
Mrps5 G A 2: 127,603,707 V385M possibly damaging Het
Ms4a15 T C 19: 10,979,226 K241E possibly damaging Het
Myt1 A G 2: 181,797,462 E259G probably damaging Het
Myt1l C A 12: 29,895,305 T1023K unknown Het
Ncapd3 T C 9: 27,086,046 L1221P probably damaging Het
Ncoa6 A G 2: 155,407,133 V1417A possibly damaging Het
Nmnat1 A G 4: 149,473,345 V80A possibly damaging Het
Nwd2 A G 5: 63,807,846 E1591G probably benign Het
Olfr1057 A G 2: 86,374,509 L301S possibly damaging Het
Olfr455 A G 6: 42,538,836 F62S probably damaging Het
Osbpl1a A T 18: 12,768,536 probably null Het
Papln T C 12: 83,774,420 I204T probably damaging Het
Phf1 A G 17: 26,934,678 T97A probably benign Het
Plxnb1 A G 9: 109,105,374 D890G probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rbp2 G A 9: 98,507,823 C96Y probably damaging Het
Rgmb A T 17: 15,807,362 M365K possibly damaging Het
Ric1 A G 19: 29,595,536 N792S possibly damaging Het
Scaf4 A G 16: 90,250,307 M394T unknown Het
Siglech T A 7: 55,768,429 C48* probably null Het
Skiv2l A G 17: 34,842,921 V695A possibly damaging Het
Slc2a5 A G 4: 150,140,005 T320A probably benign Het
Slc6a7 T C 18: 61,002,205 Y417C probably benign Het
Sox21 A G 14: 118,234,924 C238R possibly damaging Het
Tbata A T 10: 61,183,353 K109N probably damaging Het
Tecpr2 T G 12: 110,954,730 S1246A probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tenm3 A T 8: 48,313,236 probably null Het
Thada A T 17: 84,441,104 probably null Het
Tpcn2 C T 7: 145,272,351 G204R probably damaging Het
Tpm2 T C 4: 43,519,220 probably null Het
Trbv24 T C 6: 41,218,092 probably benign Het
Tyw1 A G 5: 130,277,058 R341G probably benign Het
Vmn1r183 T G 7: 24,055,139 N122K probably benign Het
Vmn2r61 T A 7: 42,267,035 H357Q possibly damaging Het
Vps13b C T 15: 35,869,372 T2674I probably damaging Het
Vps13b T C 15: 35,910,293 L3401P probably benign Het
Vps16 T G 2: 130,438,300 probably benign Het
Vrtn T A 12: 84,649,694 I406N probably damaging Het
Vwa8 A T 14: 78,934,613 Y278F probably benign Het
Washc4 A T 10: 83,579,512 I789F possibly damaging Het
Zbtb20 C A 16: 43,618,398 T627K probably damaging Het
Zfyve16 A T 13: 92,522,185 I406K probably benign Het
Zfyve9 A C 4: 108,717,998 S629A possibly damaging Het
Zpld1 A T 16: 55,248,255 N164K probably damaging Het
Other mutations in Ruvbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ruvbl1 APN 6 88484403 unclassified probably benign
IGL00473:Ruvbl1 APN 6 88491568 missense probably damaging 1.00
IGL01768:Ruvbl1 APN 6 88497271 missense probably benign
IGL03354:Ruvbl1 APN 6 88479215 nonsense probably null
R0106:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R0106:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R0145:Ruvbl1 UTSW 6 88484459 missense possibly damaging 0.90
R0676:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R1448:Ruvbl1 UTSW 6 88467569 missense probably benign 0.05
R1561:Ruvbl1 UTSW 6 88479154 missense probably damaging 1.00
R1574:Ruvbl1 UTSW 6 88479154 missense probably damaging 1.00
R1623:Ruvbl1 UTSW 6 88485770 missense probably damaging 1.00
R2113:Ruvbl1 UTSW 6 88483021 missense probably damaging 0.99
R2372:Ruvbl1 UTSW 6 88485797 missense possibly damaging 0.53
R2397:Ruvbl1 UTSW 6 88465552 missense possibly damaging 0.71
R2894:Ruvbl1 UTSW 6 88479132 missense possibly damaging 0.87
R4037:Ruvbl1 UTSW 6 88473135 missense probably damaging 1.00
R4604:Ruvbl1 UTSW 6 88485905 missense probably benign
R4684:Ruvbl1 UTSW 6 88491599 missense probably benign 0.00
R4714:Ruvbl1 UTSW 6 88484430 missense possibly damaging 0.61
R4939:Ruvbl1 UTSW 6 88483039 unclassified probably null
R5114:Ruvbl1 UTSW 6 88497290 missense probably benign 0.41
R5126:Ruvbl1 UTSW 6 88485901 missense probably benign 0.13
R5296:Ruvbl1 UTSW 6 88485908 missense probably damaging 0.99
R5507:Ruvbl1 UTSW 6 88467600 missense probably benign 0.00
R5559:Ruvbl1 UTSW 6 88473096 missense possibly damaging 0.90
R5819:Ruvbl1 UTSW 6 88483115 splice site probably null
R6048:Ruvbl1 UTSW 6 88482991 missense possibly damaging 0.90
R6155:Ruvbl1 UTSW 6 88479125 critical splice acceptor site probably null
R6564:Ruvbl1 UTSW 6 88479226 missense possibly damaging 0.93
R6704:Ruvbl1 UTSW 6 88479205 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAGAGGAGCACTGTGTCATCTG -3'
(R):5'- AAAGCATGCTTGAGGCGAGC -3'

Sequencing Primer
(F):5'- GCACTGTGTCATCTGCCCTTG -3'
(R):5'- TCTGGGTGCGCCTCCATC -3'
Posted On2016-10-20