Incidental Mutation 'R4895:Prepl'
ID434676
Institutional Source Beutler Lab
Gene Symbol Prepl
Ensembl Gene ENSMUSG00000024127
Gene Nameprolyl endopeptidase-like
Synonyms2810457N15Rik, 9530014L06Rik, D030028O16Rik
MMRRC Submission 042499-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R4895 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location85063477-85090267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85081066 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 203 (F203S)
Ref Sequence ENSEMBL: ENSMUSP00000130967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072406] [ENSMUST00000171795]
Predicted Effect probably damaging
Transcript: ENSMUST00000072406
AA Change: F116S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072239
Gene: ENSMUSG00000024127
AA Change: F116S

DomainStartEndE-ValueType
Pfam:Peptidase_S9_N 15 339 7.4e-28 PFAM
Pfam:Peptidase_S9 399 623 1.3e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171795
AA Change: F203S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130967
Gene: ENSMUSG00000024127
AA Change: F203S

DomainStartEndE-ValueType
Pfam:Peptidase_S9_N 86 428 5.2e-30 PFAM
Pfam:Peptidase_S9 486 710 2e-35 PFAM
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants encoding either the same or different isoforms have been described for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired growth and neonatal hypotonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik C A 2: 154,613,070 probably benign Het
Abat G A 16: 8,615,962 A392T probably benign Het
Abca14 G A 7: 120,247,349 probably null Het
Abcc6 A T 7: 45,980,990 L1282Q possibly damaging Het
Acss2 A G 2: 155,550,481 probably benign Het
Adgrf1 G T 17: 43,310,620 V583L probably benign Het
Aftph T C 11: 20,696,801 D825G probably damaging Het
Ahnak T C 19: 9,017,441 V5363A probably benign Het
Apba3 G A 10: 81,271,283 probably null Het
Asb13 T C 13: 3,643,589 Y116H probably damaging Het
Asb4 C A 6: 5,398,266 T77K probably damaging Het
Atp8b4 A T 2: 126,414,369 H223Q probably benign Het
Best1 A G 19: 9,992,771 L159P probably benign Het
Cacna1h A T 17: 25,389,422 M731K probably damaging Het
Catspere1 T A 1: 177,859,861 noncoding transcript Het
Cenpv A T 11: 62,527,520 Y202* probably null Het
Cep57 A T 9: 13,816,153 probably benign Het
Cfap100 T A 6: 90,406,102 D363V possibly damaging Het
Cluh A G 11: 74,667,405 Y1126C probably damaging Het
Cyp2j5 A G 4: 96,663,110 probably null Het
Dnajc11 T C 4: 151,979,933 F514L probably damaging Het
Efcab3 T A 11: 105,117,401 probably benign Het
Eif2b4 T G 5: 31,192,954 Q8P probably benign Het
Epha6 A T 16: 59,666,555 V1043E probably benign Het
Gm11562 G T 11: 99,620,315 Q20K unknown Het
Gm11639 C T 11: 104,720,286 T318I probably benign Het
Gm11639 A G 11: 104,749,670 D1026G probably damaging Het
Gm13762 A T 2: 88,973,711 F60Y probably benign Het
Gm14415 A T 2: 177,104,321 noncoding transcript Het
Gm5431 A G 11: 48,889,028 S634P probably damaging Het
Gpld1 C A 13: 24,979,728 N501K probably damaging Het
Gsn C T 2: 35,302,578 R513C probably damaging Het
Gulp1 T C 1: 44,788,597 F300L probably benign Het
H2afj T C 6: 136,808,662 V108A possibly damaging Het
Haus3 T C 5: 34,168,070 R82G probably benign Het
Herc2 G A 7: 56,222,986 R4424H probably damaging Het
Hmcn1 T A 1: 150,677,379 Q2520L probably benign Het
Hs2st1 T C 3: 144,465,253 I53V probably benign Het
Inpp5e C T 2: 26,397,912 R624Q probably damaging Het
Ints8 G T 4: 11,230,367 C491* probably null Het
Itpkb C A 1: 180,413,895 A710D probably damaging Het
Kcnk4 A C 19: 6,928,416 probably null Het
Kmt2d T C 15: 98,844,487 probably benign Het
Lamb3 C T 1: 193,332,314 R594* probably null Het
Map3k20 A G 2: 72,402,356 probably benign Het
Maz A T 7: 127,025,300 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Nbeal1 A G 1: 60,292,903 E2252G probably damaging Het
Ndufa10 A G 1: 92,469,896 Y61H probably damaging Het
Npat T A 9: 53,570,489 L1166M probably damaging Het
Olfr1112 A C 2: 87,191,848 I54L probably benign Het
Olfr1447 C T 19: 12,900,887 V298M probably damaging Het
Olfr190 C T 16: 59,074,657 C141Y probably benign Het
Olfr490 A C 7: 108,286,595 I177S probably damaging Het
Olfr988 A T 2: 85,352,997 *310K probably null Het
Pcdhb3 T C 18: 37,301,706 F242L probably damaging Het
Phip A G 9: 82,959,595 V57A probably benign Het
Plekha7 A T 7: 116,189,391 probably null Het
Pot1a A C 6: 25,753,206 F444V probably damaging Het
Ppm1a C T 12: 72,784,352 P217L probably damaging Het
Prl8a1 T C 13: 27,575,530 I175V probably benign Het
Ranbp6 A T 19: 29,809,775 I1059N possibly damaging Het
Rhag A G 17: 40,811,351 Q59R probably benign Het
Sema4c A C 1: 36,553,570 probably null Het
Sf3b3 T C 8: 110,816,024 D902G probably benign Het
Tbc1d23 A G 16: 57,198,857 probably null Het
Tbrg1 A T 9: 37,655,079 I54N probably damaging Het
Tchh A T 3: 93,445,686 E811V unknown Het
Tenm3 T A 8: 48,300,971 D799V probably damaging Het
Tlr5 T C 1: 182,974,199 L342P probably damaging Het
Tppp C T 13: 74,030,877 R146* probably null Het
Trpm4 A T 7: 45,318,058 M574K probably damaging Het
Uggt1 A T 1: 36,156,264 F1288Y probably damaging Het
Uggt2 T A 14: 119,018,886 K1124N probably damaging Het
Usf3 A C 16: 44,221,096 S1980R possibly damaging Het
Vav2 T C 2: 27,318,961 D100G probably damaging Het
Vmn2r3 G T 3: 64,259,761 H650N probably benign Het
Vmn2r59 T A 7: 42,045,794 Y398F probably damaging Het
Zfp619 A G 7: 39,537,972 D1142G possibly damaging Het
Zfp933 G A 4: 147,826,435 R235* probably null Het
Other mutations in Prepl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Prepl APN 17 85078507 missense probably damaging 1.00
IGL01375:Prepl APN 17 85071991 missense possibly damaging 0.92
IGL01618:Prepl APN 17 85066281 missense probably damaging 1.00
IGL01633:Prepl APN 17 85072016 missense probably benign 0.03
IGL01730:Prepl APN 17 85081175 missense possibly damaging 0.82
IGL02728:Prepl APN 17 85070582 missense probably damaging 1.00
R0126:Prepl UTSW 17 85083242 missense probably benign 0.19
R0243:Prepl UTSW 17 85065038 unclassified probably null
R1071:Prepl UTSW 17 85070512 missense probably damaging 1.00
R1437:Prepl UTSW 17 85088357 missense probably damaging 1.00
R1638:Prepl UTSW 17 85072081 missense probably benign 0.04
R1892:Prepl UTSW 17 85088450 missense possibly damaging 0.82
R1967:Prepl UTSW 17 85088551 start codon destroyed probably null 0.99
R4196:Prepl UTSW 17 85081154 missense probably benign
R4630:Prepl UTSW 17 85083231 missense probably benign 0.00
R4632:Prepl UTSW 17 85083231 missense probably benign 0.00
R4932:Prepl UTSW 17 85078504 missense possibly damaging 0.66
R4969:Prepl UTSW 17 85088474 missense probably benign 0.00
R5954:Prepl UTSW 17 85064649 missense probably benign 0.04
R6259:Prepl UTSW 17 85070431 missense probably damaging 1.00
R6273:Prepl UTSW 17 85083268 missense probably benign 0.00
R7176:Prepl UTSW 17 85069026 missense probably benign 0.14
R7273:Prepl UTSW 17 85081992 missense probably benign 0.10
R7291:Prepl UTSW 17 85081240 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CAGTGTGTCTATCTCCATGTGG -3'
(R):5'- CTGGAAGAACTTAAATTGGATCAGC -3'

Sequencing Primer
(F):5'- TGAAAACTGCCCATGGGTTC -3'
(R):5'- CAGCCTTTCATTGATTGCATCAGAG -3'
Posted On2016-10-24