Incidental Mutation 'R5534:Ccdc141'
ID434682
Institutional Source Beutler Lab
Gene Symbol Ccdc141
Ensembl Gene ENSMUSG00000044033
Gene Namecoiled-coil domain containing 141
SynonymsENSMUSG00000075261, 2610301F02Rik, CAMDI
MMRRC Submission 043092-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5534 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location77009902-77170636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77057897 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 508 (V508A)
Ref Sequence ENSEMBL: ENSMUSP00000128736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049544] [ENSMUST00000164114]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028406
Predicted Effect probably benign
Transcript: ENSMUST00000049544
AA Change: V508A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052945
Gene: ENSMUSG00000044033
AA Change: V508A

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 1e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 2e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 9e-63 BLAST
low complexity region 1203 1231 N/A INTRINSIC
Blast:IG 1305 1416 5e-54 BLAST
SCOP:d1g1ca_ 1406 1443 1e-9 SMART
Blast:IG 1416 1444 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164114
AA Change: V508A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128736
Gene: ENSMUSG00000044033
AA Change: V508A

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 2e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 3e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 1e-62 BLAST
low complexity region 1203 1231 N/A INTRINSIC
IGc2 1422 1489 1.27e-5 SMART
transmembrane domain 1510 1529 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout impairs migration of neurons in the somatosensory cortex, resulting in increased anxiety and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,228,835 F2188L probably benign Het
Adam18 T A 8: 24,665,514 D163V probably benign Het
Ank2 A T 3: 126,947,298 probably benign Het
Ankmy1 T C 1: 92,886,720 E355G probably damaging Het
Ankmy2 A G 12: 36,182,492 N172S probably damaging Het
Ankrd50 A G 3: 38,456,082 M712T probably damaging Het
Apcdd1 T C 18: 62,937,034 I124T probably benign Het
Carmil3 A G 14: 55,494,890 K256R probably damaging Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Ccdc33 A G 9: 58,117,167 S226P possibly damaging Het
Cep72 T C 13: 74,062,216 E9G probably benign Het
Clca4b A T 3: 144,915,466 Y616N probably damaging Het
Cnot4 A G 6: 35,078,004 S117P possibly damaging Het
Col11a2 C T 17: 34,051,024 A429V probably damaging Het
Col4a4 T C 1: 82,487,517 E979G unknown Het
Coq10b T C 1: 55,064,200 Y46H possibly damaging Het
Dnah17 T C 11: 118,052,770 T3169A possibly damaging Het
Dock6 G A 9: 21,803,076 R1824* probably null Het
Dsp A C 13: 38,195,842 I1589L probably benign Het
Edil3 A G 13: 89,199,474 T383A probably benign Het
Efemp1 T C 11: 28,867,758 V79A probably damaging Het
Esyt1 C T 10: 128,519,460 V471I probably benign Het
Fbxo30 T C 10: 11,289,665 S44P possibly damaging Het
Fdx1l G T 9: 21,073,266 D57E probably benign Het
Gbp11 A T 5: 105,331,038 V178D probably damaging Het
Gm13084 G T 4: 143,812,599 S108* probably null Het
Gna11 A T 10: 81,531,133 I283N probably damaging Het
Grid2 A T 6: 63,503,361 Q53L probably benign Het
Jmjd6 A G 11: 116,840,426 S266P probably damaging Het
Kdelc1 C T 1: 44,112,677 V351M probably damaging Het
Kirrel G A 3: 87,090,518 R233C probably damaging Het
Kmt2d A G 15: 98,837,357 probably benign Het
Lama3 A T 18: 12,553,210 T1171S probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Med13 A T 11: 86,319,365 S650R probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mgat1 T C 11: 49,261,149 V153A probably benign Het
Mmp16 A T 4: 18,110,452 D416V probably damaging Het
Myh3 A T 11: 67,097,044 R1448W probably damaging Het
Nedd1 A T 10: 92,695,032 F398L probably benign Het
Olfr1009 T C 2: 85,721,987 I194T probably benign Het
Olfr1295 T C 2: 111,565,004 T147A probably benign Het
Olfr199 T C 16: 59,216,040 D191G probably benign Het
Olfr237-ps1 A G 6: 43,153,633 I109M probably benign Het
Otud3 A G 4: 138,897,583 L269P probably damaging Het
Otx1 A G 11: 21,996,296 probably benign Het
Pcdhga7 A C 18: 37,716,278 D446A probably damaging Het
Pcnx2 T G 8: 125,838,015 K1046N possibly damaging Het
Pfkp C A 13: 6,648,583 G33W probably damaging Het
Pold1 A G 7: 44,538,619 I585T probably damaging Het
Pole4 A G 6: 82,652,134 Y84H possibly damaging Het
Ptpn23 A G 9: 110,392,741 S126P possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rin3 T C 12: 102,387,632 L766P probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rras2 G A 7: 114,050,415 T138I possibly damaging Het
Scrn2 A G 11: 97,030,925 I74V probably benign Het
Sema6d T C 2: 124,659,815 I526T possibly damaging Het
Shd G T 17: 55,971,577 E47* probably null Het
Slc22a27 T C 19: 7,926,631 H47R probably damaging Het
Slc36a3 C G 11: 55,142,769 W141S possibly damaging Het
Slc9c1 T A 16: 45,556,614 V429E probably benign Het
Smg8 A T 11: 87,085,470 D428E probably benign Het
Snrpe A T 1: 133,606,473 F84Y probably benign Het
Tbc1d2b C T 9: 90,227,506 D306N possibly damaging Het
Trav9n-4 A G 14: 53,294,899 Y70C probably damaging Het
Ush1c A G 7: 46,221,423 I330T probably damaging Het
Wnt11 T C 7: 98,839,142 L12P probably damaging Het
Zan A G 5: 137,438,451 S2047P unknown Het
Zcchc6 A G 13: 59,788,553 F843L probably damaging Het
Zfp763 A C 17: 33,021,794 S20R probably damaging Het
Other mutations in Ccdc141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Ccdc141 APN 2 77054644 missense probably damaging 0.98
IGL01396:Ccdc141 APN 2 77128325 missense possibly damaging 0.87
IGL01408:Ccdc141 APN 2 77045679 missense probably benign 0.01
IGL01633:Ccdc141 APN 2 77089249 missense probably benign 0.01
IGL01982:Ccdc141 APN 2 77030659 missense probably damaging 1.00
IGL02105:Ccdc141 APN 2 77049577 critical splice donor site probably null
IGL02307:Ccdc141 APN 2 77029342 missense probably damaging 1.00
IGL02645:Ccdc141 APN 2 77074867 nonsense probably null
IGL02737:Ccdc141 APN 2 77057924 missense probably damaging 0.97
IGL02740:Ccdc141 APN 2 77054609 missense probably benign 0.05
IGL02949:Ccdc141 APN 2 77027594 missense probably damaging 1.00
IGL03127:Ccdc141 APN 2 77029235 critical splice donor site probably null
verloren UTSW 2 77027648 missense probably damaging 1.00
verschied UTSW 2 77108356 splice site probably benign
R0153:Ccdc141 UTSW 2 77165238 intron probably benign
R0384:Ccdc141 UTSW 2 77027648 missense probably damaging 1.00
R0423:Ccdc141 UTSW 2 77039450 missense probably damaging 0.96
R0573:Ccdc141 UTSW 2 77039493 missense probably benign 0.00
R1332:Ccdc141 UTSW 2 77014440 missense probably damaging 1.00
R1336:Ccdc141 UTSW 2 77014440 missense probably damaging 1.00
R1355:Ccdc141 UTSW 2 77030601 missense probably damaging 1.00
R1416:Ccdc141 UTSW 2 77014796 missense probably damaging 1.00
R1659:Ccdc141 UTSW 2 77054683 missense probably benign 0.41
R1726:Ccdc141 UTSW 2 77108356 splice site probably benign
R1799:Ccdc141 UTSW 2 77011671 missense possibly damaging 0.88
R1837:Ccdc141 UTSW 2 77011665 missense probably benign 0.00
R1839:Ccdc141 UTSW 2 77011665 missense probably benign 0.00
R1918:Ccdc141 UTSW 2 77014703 missense probably benign 0.00
R2019:Ccdc141 UTSW 2 77011565 missense probably damaging 1.00
R2133:Ccdc141 UTSW 2 77059607 missense probably benign 0.28
R2158:Ccdc141 UTSW 2 77030671 missense probably damaging 1.00
R2256:Ccdc141 UTSW 2 77132262 missense probably damaging 1.00
R2359:Ccdc141 UTSW 2 77170402 missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 77011542 missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 77074998 missense probably benign 0.11
R3110:Ccdc141 UTSW 2 77039486 missense probably benign 0.31
R3112:Ccdc141 UTSW 2 77039486 missense probably benign 0.31
R4334:Ccdc141 UTSW 2 77170432 missense probably damaging 1.00
R4493:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R4494:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R4628:Ccdc141 UTSW 2 77059680 missense probably benign 0.02
R4748:Ccdc141 UTSW 2 77057980 missense possibly damaging 0.67
R4810:Ccdc141 UTSW 2 77045755 missense possibly damaging 0.73
R4824:Ccdc141 UTSW 2 77124336 missense probably damaging 0.99
R4829:Ccdc141 UTSW 2 77074916 missense probably damaging 0.99
R4920:Ccdc141 UTSW 2 77168563 missense probably damaging 1.00
R5024:Ccdc141 UTSW 2 77054703 missense probably benign 0.17
R5073:Ccdc141 UTSW 2 77124378 splice site probably null
R5251:Ccdc141 UTSW 2 77027774 missense probably damaging 1.00
R5252:Ccdc141 UTSW 2 77132249 missense probably benign 0.03
R5539:Ccdc141 UTSW 2 77015093 missense probably damaging 0.98
R5551:Ccdc141 UTSW 2 77014409 missense probably damaging 1.00
R5784:Ccdc141 UTSW 2 77029327 missense probably damaging 1.00
R5837:Ccdc141 UTSW 2 77108437 missense possibly damaging 0.56
R5850:Ccdc141 UTSW 2 77029403 missense probably damaging 0.98
R6050:Ccdc141 UTSW 2 77011731 missense probably benign 0.33
R6263:Ccdc141 UTSW 2 77108463 missense probably damaging 1.00
R6502:Ccdc141 UTSW 2 77170401 missense probably damaging 1.00
R6580:Ccdc141 UTSW 2 77011755 missense possibly damaging 0.50
R6865:Ccdc141 UTSW 2 77029235 critical splice donor site probably null
R7014:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R7094:Ccdc141 UTSW 2 77041453 missense possibly damaging 0.83
R7195:Ccdc141 UTSW 2 77049583 missense probably benign 0.39
R7300:Ccdc141 UTSW 2 77014694 missense probably benign 0.00
Z1088:Ccdc141 UTSW 2 77128272 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAACTACAGTTGCCTACAGTTGC -3'
(R):5'- AGTATGGCATCATATGAAGATCAGC -3'

Sequencing Primer
(F):5'- ACTTTGTAAACCAGGTTGGCC -3'
(R):5'- GGCATCATATGAAGATCAGCATTATC -3'
Posted On2016-10-24