Incidental Mutation 'R5534:Pcnx2'
ID434711
Institutional Source Beutler Lab
Gene Symbol Pcnx2
Ensembl Gene ENSMUSG00000060212
Gene Namepecanex homolog 2
SynonymsPcnxl2, E330039K12Rik
MMRRC Submission 043092-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5534 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125751508-125898317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 125838015 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1046 (K1046N)
Ref Sequence ENSEMBL: ENSMUSP00000119965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047239] [ENSMUST00000131127]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047239
AA Change: K1046N

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: K1046N

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 881 902 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 976 998 N/A INTRINSIC
transmembrane domain 1011 1030 N/A INTRINSIC
transmembrane domain 1080 1102 N/A INTRINSIC
transmembrane domain 1104 1126 N/A INTRINSIC
Pfam:Pecanex_C 1603 1828 3.5e-113 PFAM
low complexity region 1864 1889 N/A INTRINSIC
low complexity region 1968 1981 N/A INTRINSIC
low complexity region 2004 2019 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120589
SMART Domains Protein: ENSMUSP00000113111
Gene: ENSMUSG00000060212

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Pecanex_C 533 762 4e-122 PFAM
low complexity region 797 822 N/A INTRINSIC
low complexity region 901 914 N/A INTRINSIC
low complexity region 937 952 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131127
AA Change: K1046N

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119965
Gene: ENSMUSG00000060212
AA Change: K1046N

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 968 990 N/A INTRINSIC
transmembrane domain 1010 1029 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,228,835 F2188L probably benign Het
Adam18 T A 8: 24,665,514 D163V probably benign Het
Ank2 A T 3: 126,947,298 probably benign Het
Ankmy1 T C 1: 92,886,720 E355G probably damaging Het
Ankmy2 A G 12: 36,182,492 N172S probably damaging Het
Ankrd50 A G 3: 38,456,082 M712T probably damaging Het
Apcdd1 T C 18: 62,937,034 I124T probably benign Het
Carmil3 A G 14: 55,494,890 K256R probably damaging Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Ccdc141 A G 2: 77,057,897 V508A probably benign Het
Ccdc33 A G 9: 58,117,167 S226P possibly damaging Het
Cep72 T C 13: 74,062,216 E9G probably benign Het
Clca4b A T 3: 144,915,466 Y616N probably damaging Het
Cnot4 A G 6: 35,078,004 S117P possibly damaging Het
Col11a2 C T 17: 34,051,024 A429V probably damaging Het
Col4a4 T C 1: 82,487,517 E979G unknown Het
Coq10b T C 1: 55,064,200 Y46H possibly damaging Het
Dnah17 T C 11: 118,052,770 T3169A possibly damaging Het
Dock6 G A 9: 21,803,076 R1824* probably null Het
Dsp A C 13: 38,195,842 I1589L probably benign Het
Edil3 A G 13: 89,199,474 T383A probably benign Het
Efemp1 T C 11: 28,867,758 V79A probably damaging Het
Esyt1 C T 10: 128,519,460 V471I probably benign Het
Fbxo30 T C 10: 11,289,665 S44P possibly damaging Het
Fdx1l G T 9: 21,073,266 D57E probably benign Het
Gbp11 A T 5: 105,331,038 V178D probably damaging Het
Gm13084 G T 4: 143,812,599 S108* probably null Het
Gna11 A T 10: 81,531,133 I283N probably damaging Het
Grid2 A T 6: 63,503,361 Q53L probably benign Het
Jmjd6 A G 11: 116,840,426 S266P probably damaging Het
Kdelc1 C T 1: 44,112,677 V351M probably damaging Het
Kirrel G A 3: 87,090,518 R233C probably damaging Het
Kmt2d A G 15: 98,837,357 probably benign Het
Lama3 A T 18: 12,553,210 T1171S probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Med13 A T 11: 86,319,365 S650R probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mgat1 T C 11: 49,261,149 V153A probably benign Het
Mmp16 A T 4: 18,110,452 D416V probably damaging Het
Myh3 A T 11: 67,097,044 R1448W probably damaging Het
Nedd1 A T 10: 92,695,032 F398L probably benign Het
Olfr1009 T C 2: 85,721,987 I194T probably benign Het
Olfr1295 T C 2: 111,565,004 T147A probably benign Het
Olfr199 T C 16: 59,216,040 D191G probably benign Het
Olfr237-ps1 A G 6: 43,153,633 I109M probably benign Het
Otud3 A G 4: 138,897,583 L269P probably damaging Het
Otx1 A G 11: 21,996,296 probably benign Het
Pcdhga7 A C 18: 37,716,278 D446A probably damaging Het
Pfkp C A 13: 6,648,583 G33W probably damaging Het
Pold1 A G 7: 44,538,619 I585T probably damaging Het
Pole4 A G 6: 82,652,134 Y84H possibly damaging Het
Ptpn23 A G 9: 110,392,741 S126P possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rin3 T C 12: 102,387,632 L766P probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rras2 G A 7: 114,050,415 T138I possibly damaging Het
Scrn2 A G 11: 97,030,925 I74V probably benign Het
Sema6d T C 2: 124,659,815 I526T possibly damaging Het
Shd G T 17: 55,971,577 E47* probably null Het
Slc22a27 T C 19: 7,926,631 H47R probably damaging Het
Slc36a3 C G 11: 55,142,769 W141S possibly damaging Het
Slc9c1 T A 16: 45,556,614 V429E probably benign Het
Smg8 A T 11: 87,085,470 D428E probably benign Het
Snrpe A T 1: 133,606,473 F84Y probably benign Het
Tbc1d2b C T 9: 90,227,506 D306N possibly damaging Het
Trav9n-4 A G 14: 53,294,899 Y70C probably damaging Het
Ush1c A G 7: 46,221,423 I330T probably damaging Het
Wnt11 T C 7: 98,839,142 L12P probably damaging Het
Zan A G 5: 137,438,451 S2047P unknown Het
Zcchc6 A G 13: 59,788,553 F843L probably damaging Het
Zfp763 A C 17: 33,021,794 S20R probably damaging Het
Other mutations in Pcnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcnx2 APN 8 125887585 missense probably damaging 1.00
IGL00900:Pcnx2 APN 8 125863236 splice site probably benign
IGL01134:Pcnx2 APN 8 125863150 missense probably benign
IGL01370:Pcnx2 APN 8 125801483 missense probably damaging 0.96
IGL01452:Pcnx2 APN 8 125838032 missense probably damaging 1.00
IGL01477:Pcnx2 APN 8 125785305 missense probably damaging 1.00
IGL01610:Pcnx2 APN 8 125839633 missense possibly damaging 0.67
IGL01640:Pcnx2 APN 8 125801558 missense probably benign 0.14
IGL01645:Pcnx2 APN 8 125887917 missense probably damaging 1.00
IGL01876:Pcnx2 APN 8 125866031 missense probably benign 0.31
IGL01933:Pcnx2 APN 8 125761654 missense probably damaging 1.00
IGL02208:Pcnx2 APN 8 125752155 missense probably benign 0.30
IGL02573:Pcnx2 APN 8 125855273 missense probably benign 0.34
IGL02810:Pcnx2 APN 8 125887203 missense probably benign 0.03
IGL02859:Pcnx2 APN 8 125863173 missense probably damaging 1.00
IGL02879:Pcnx2 APN 8 125772057 missense probably damaging 1.00
IGL03202:Pcnx2 APN 8 125772044 missense probably damaging 0.98
IGL03259:Pcnx2 APN 8 125753649 missense probably benign 0.19
IGL03395:Pcnx2 APN 8 125887523 missense probably benign 0.00
IGL03410:Pcnx2 APN 8 125887040 missense probably damaging 1.00
gallen UTSW 8 125891120 missense probably damaging 1.00
hotzone UTSW 8 125891141 missense probably benign 0.00
R0107:Pcnx2 UTSW 8 125753586 missense probably benign 0.29
R0477:Pcnx2 UTSW 8 125761567 missense probably damaging 0.99
R0610:Pcnx2 UTSW 8 125839687 missense probably damaging 1.00
R0645:Pcnx2 UTSW 8 125760720 missense possibly damaging 0.64
R0894:Pcnx2 UTSW 8 125886926 splice site probably benign
R1083:Pcnx2 UTSW 8 125772104 missense probably damaging 1.00
R1199:Pcnx2 UTSW 8 125887314 missense possibly damaging 0.60
R1296:Pcnx2 UTSW 8 125773833 missense probably damaging 1.00
R1445:Pcnx2 UTSW 8 125752284 missense probably damaging 0.99
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1524:Pcnx2 UTSW 8 125891141 missense probably benign 0.00
R1537:Pcnx2 UTSW 8 125877449 missense possibly damaging 0.94
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1593:Pcnx2 UTSW 8 125759273 missense probably benign 0.11
R1598:Pcnx2 UTSW 8 125772086 missense probably benign 0.03
R1603:Pcnx2 UTSW 8 125839626 missense probably damaging 1.00
R1697:Pcnx2 UTSW 8 125850348 missense probably damaging 1.00
R1759:Pcnx2 UTSW 8 125773978 missense probably damaging 1.00
R1855:Pcnx2 UTSW 8 125807996 splice site probably benign
R1863:Pcnx2 UTSW 8 125818786 missense probably damaging 0.98
R1930:Pcnx2 UTSW 8 125887714 missense probably benign 0.10
R1967:Pcnx2 UTSW 8 125815683 missense possibly damaging 0.51
R1974:Pcnx2 UTSW 8 125887371 missense probably benign 0.00
R1998:Pcnx2 UTSW 8 125887143 missense probably damaging 1.00
R2034:Pcnx2 UTSW 8 125818667 critical splice donor site probably null
R2072:Pcnx2 UTSW 8 125761742 missense possibly damaging 0.90
R2096:Pcnx2 UTSW 8 125759248 missense probably benign 0.27
R2216:Pcnx2 UTSW 8 125888077 missense probably benign 0.00
R2290:Pcnx2 UTSW 8 125877595 splice site probably benign
R2373:Pcnx2 UTSW 8 125753451 missense probably damaging 1.00
R2484:Pcnx2 UTSW 8 125891120 missense probably damaging 1.00
R2849:Pcnx2 UTSW 8 125760927 missense probably damaging 1.00
R2891:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2892:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2970:Pcnx2 UTSW 8 125801536 missense probably damaging 1.00
R3013:Pcnx2 UTSW 8 125887770 missense probably benign 0.05
R3608:Pcnx2 UTSW 8 125888101 missense probably benign
R3876:Pcnx2 UTSW 8 125888158 missense probably benign
R4349:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4352:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4353:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4361:Pcnx2 UTSW 8 125768298 nonsense probably null
R4735:Pcnx2 UTSW 8 125828041 critical splice donor site probably null
R4749:Pcnx2 UTSW 8 125887588 missense probably damaging 1.00
R4812:Pcnx2 UTSW 8 125865939 missense probably benign 0.00
R4819:Pcnx2 UTSW 8 125855230 missense probably benign 0.04
R4829:Pcnx2 UTSW 8 125861058 intron probably null
R4832:Pcnx2 UTSW 8 125752188 missense probably damaging 0.99
R4876:Pcnx2 UTSW 8 125772108 missense probably damaging 1.00
R4974:Pcnx2 UTSW 8 125851130 missense probably benign 0.00
R5057:Pcnx2 UTSW 8 125855191 missense possibly damaging 0.95
R5078:Pcnx2 UTSW 8 125752156 missense probably benign
R5114:Pcnx2 UTSW 8 125838010 missense possibly damaging 0.89
R5195:Pcnx2 UTSW 8 125801549 missense possibly damaging 0.69
R5239:Pcnx2 UTSW 8 125861082 intron probably null
R5348:Pcnx2 UTSW 8 125818756 missense probably damaging 1.00
R5398:Pcnx2 UTSW 8 125887948 missense possibly damaging 0.63
R5448:Pcnx2 UTSW 8 125888149 missense probably benign 0.14
R5624:Pcnx2 UTSW 8 125761523 critical splice donor site probably null
R5629:Pcnx2 UTSW 8 125898041 missense probably damaging 1.00
R5630:Pcnx2 UTSW 8 125860958 missense probably damaging 0.99
R5782:Pcnx2 UTSW 8 125753484 missense probably damaging 1.00
R5877:Pcnx2 UTSW 8 125753728 missense probably damaging 0.99
R5879:Pcnx2 UTSW 8 125773946 missense probably damaging 1.00
R6114:Pcnx2 UTSW 8 125773947 missense probably damaging 1.00
R6152:Pcnx2 UTSW 8 125753752 missense probably damaging 0.99
R6154:Pcnx2 UTSW 8 125762813 missense probably damaging 1.00
R6283:Pcnx2 UTSW 8 125877586 missense probably damaging 0.99
R6500:Pcnx2 UTSW 8 125753485 missense probably damaging 1.00
R6629:Pcnx2 UTSW 8 125891112 missense probably benign 0.00
R6708:Pcnx2 UTSW 8 125860953 critical splice donor site probably null
R6736:Pcnx2 UTSW 8 125752317 splice site probably null
R6748:Pcnx2 UTSW 8 125850335 missense probably damaging 1.00
R6788:Pcnx2 UTSW 8 125772100 missense probably damaging 1.00
R6849:Pcnx2 UTSW 8 125861210 missense probably damaging 1.00
R6947:Pcnx2 UTSW 8 125850282 critical splice donor site probably null
R7034:Pcnx2 UTSW 8 125785302 missense probably damaging 1.00
R7100:Pcnx2 UTSW 8 125759114 missense probably benign 0.16
R7124:Pcnx2 UTSW 8 125753617 missense probably damaging 0.99
R7130:Pcnx2 UTSW 8 125753584 nonsense probably null
R7133:Pcnx2 UTSW 8 125801504 missense probably benign 0.01
R7271:Pcnx2 UTSW 8 125886951 missense probably benign
Z1088:Pcnx2 UTSW 8 125826928 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125866018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCCAGCTAGCTCACTGTATC -3'
(R):5'- TGCCTGGCCACTTTTGTCAG -3'

Sequencing Primer
(F):5'- AGCTCACTGTATCCTGGCAAC -3'
(R):5'- GCAGCCTGAATGTGATTCAC -3'
Posted On2016-10-24