Incidental Mutation 'R5534:Dock6'
ID434712
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 043092-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R5534 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 21803076 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1824 (R1824*)
Ref Sequence ENSEMBL: ENSMUSP00000149156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034717] [ENSMUST00000034728] [ENSMUST00000213691] [ENSMUST00000216008] [ENSMUST00000217336]
Predicted Effect probably benign
Transcript: ENSMUST00000034717
SMART Domains Protein: ENSMUSP00000034717
Gene: ENSMUSG00000032194

DomainStartEndE-ValueType
Pfam:KN_motif 31 69 9.6e-26 PFAM
low complexity region 139 157 N/A INTRINSIC
coiled coil region 213 229 N/A INTRINSIC
coiled coil region 284 316 N/A INTRINSIC
low complexity region 324 343 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
ANK 658 688 6.36e-3 SMART
ANK 692 725 7.29e2 SMART
ANK 730 759 4.97e-5 SMART
ANK 763 793 3.85e-2 SMART
ANK 797 825 1.06e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000034728
AA Change: R1793*
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: R1793*

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213691
Predicted Effect silent
Transcript: ENSMUST00000215729
Predicted Effect probably benign
Transcript: ENSMUST00000216008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217310
Predicted Effect probably null
Transcript: ENSMUST00000217336
AA Change: R1824*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,228,835 F2188L probably benign Het
Adam18 T A 8: 24,665,514 D163V probably benign Het
Ank2 A T 3: 126,947,298 probably benign Het
Ankmy1 T C 1: 92,886,720 E355G probably damaging Het
Ankmy2 A G 12: 36,182,492 N172S probably damaging Het
Ankrd50 A G 3: 38,456,082 M712T probably damaging Het
Apcdd1 T C 18: 62,937,034 I124T probably benign Het
Carmil3 A G 14: 55,494,890 K256R probably damaging Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Ccdc141 A G 2: 77,057,897 V508A probably benign Het
Ccdc33 A G 9: 58,117,167 S226P possibly damaging Het
Cep72 T C 13: 74,062,216 E9G probably benign Het
Clca4b A T 3: 144,915,466 Y616N probably damaging Het
Cnot4 A G 6: 35,078,004 S117P possibly damaging Het
Col11a2 C T 17: 34,051,024 A429V probably damaging Het
Col4a4 T C 1: 82,487,517 E979G unknown Het
Coq10b T C 1: 55,064,200 Y46H possibly damaging Het
Dnah17 T C 11: 118,052,770 T3169A possibly damaging Het
Dsp A C 13: 38,195,842 I1589L probably benign Het
Edil3 A G 13: 89,199,474 T383A probably benign Het
Efemp1 T C 11: 28,867,758 V79A probably damaging Het
Esyt1 C T 10: 128,519,460 V471I probably benign Het
Fbxo30 T C 10: 11,289,665 S44P possibly damaging Het
Fdx1l G T 9: 21,073,266 D57E probably benign Het
Gbp11 A T 5: 105,331,038 V178D probably damaging Het
Gm13084 G T 4: 143,812,599 S108* probably null Het
Gna11 A T 10: 81,531,133 I283N probably damaging Het
Grid2 A T 6: 63,503,361 Q53L probably benign Het
Jmjd6 A G 11: 116,840,426 S266P probably damaging Het
Kdelc1 C T 1: 44,112,677 V351M probably damaging Het
Kirrel G A 3: 87,090,518 R233C probably damaging Het
Kmt2d A G 15: 98,837,357 probably benign Het
Lama3 A T 18: 12,553,210 T1171S probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Med13 A T 11: 86,319,365 S650R probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mgat1 T C 11: 49,261,149 V153A probably benign Het
Mmp16 A T 4: 18,110,452 D416V probably damaging Het
Myh3 A T 11: 67,097,044 R1448W probably damaging Het
Nedd1 A T 10: 92,695,032 F398L probably benign Het
Olfr1009 T C 2: 85,721,987 I194T probably benign Het
Olfr1295 T C 2: 111,565,004 T147A probably benign Het
Olfr199 T C 16: 59,216,040 D191G probably benign Het
Olfr237-ps1 A G 6: 43,153,633 I109M probably benign Het
Otud3 A G 4: 138,897,583 L269P probably damaging Het
Otx1 A G 11: 21,996,296 probably benign Het
Pcdhga7 A C 18: 37,716,278 D446A probably damaging Het
Pcnx2 T G 8: 125,838,015 K1046N possibly damaging Het
Pfkp C A 13: 6,648,583 G33W probably damaging Het
Pold1 A G 7: 44,538,619 I585T probably damaging Het
Pole4 A G 6: 82,652,134 Y84H possibly damaging Het
Ptpn23 A G 9: 110,392,741 S126P possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rin3 T C 12: 102,387,632 L766P probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rras2 G A 7: 114,050,415 T138I possibly damaging Het
Scrn2 A G 11: 97,030,925 I74V probably benign Het
Sema6d T C 2: 124,659,815 I526T possibly damaging Het
Shd G T 17: 55,971,577 E47* probably null Het
Slc22a27 T C 19: 7,926,631 H47R probably damaging Het
Slc36a3 C G 11: 55,142,769 W141S possibly damaging Het
Slc9c1 T A 16: 45,556,614 V429E probably benign Het
Smg8 A T 11: 87,085,470 D428E probably benign Het
Snrpe A T 1: 133,606,473 F84Y probably benign Het
Tbc1d2b C T 9: 90,227,506 D306N possibly damaging Het
Trav9n-4 A G 14: 53,294,899 Y70C probably damaging Het
Ush1c A G 7: 46,221,423 I330T probably damaging Het
Wnt11 T C 7: 98,839,142 L12P probably damaging Het
Zan A G 5: 137,438,451 S2047P unknown Het
Zcchc6 A G 13: 59,788,553 F843L probably damaging Het
Zfp763 A C 17: 33,021,794 S20R probably damaging Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AAAGACACGGGGTTGACTCC -3'
(R):5'- TGACCAGCCTTTGTGATCC -3'

Sequencing Primer
(F):5'- ACTCCGGGTCAGCTGGG -3'
(R):5'- TGTGTCTGAGATCCCCAGACAG -3'
Posted On2016-10-24