Incidental Mutation 'R5534:Col11a2'
ID434750
Institutional Source Beutler Lab
Gene Symbol Col11a2
Ensembl Gene ENSMUSG00000024330
Gene Namecollagen, type XI, alpha 2
Synonyms
MMRRC Submission 043092-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R5534 (G1)
Quality Score208
Status Not validated
Chromosome17
Chromosomal Location34039437-34066685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34051024 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 429 (A429V)
Ref Sequence ENSEMBL: ENSMUSP00000109893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000131134] [ENSMUST00000143354]
Predicted Effect unknown
Transcript: ENSMUST00000087497
AA Change: A390V
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330
AA Change: A390V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114252
AA Change: A395V

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330
AA Change: A395V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114255
AA Change: A429V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330
AA Change: A429V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131134
AA Change: A476V

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122082
Gene: ENSMUSG00000024330
AA Change: A476V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 303 314 N/A INTRINSIC
low complexity region 342 354 N/A INTRINSIC
Pfam:Collagen 392 450 7.8e-10 PFAM
Pfam:Collagen 484 543 1.4e-10 PFAM
Pfam:Collagen 514 581 9.5e-11 PFAM
Pfam:Collagen 565 624 2.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137374
Predicted Effect possibly damaging
Transcript: ENSMUST00000143354
AA Change: A82V

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115026
Gene: ENSMUSG00000024330
AA Change: A82V

DomainStartEndE-ValueType
Pfam:Collagen 3 56 4.7e-9 PFAM
Pfam:Collagen 91 152 1.7e-9 PFAM
internal_repeat_1 158 301 3.7e-11 PROSPERO
internal_repeat_2 276 321 1.18e-9 PROSPERO
internal_repeat_4 291 306 1.06e-5 PROSPERO
internal_repeat_3 303 353 1.87e-6 PROSPERO
internal_repeat_2 315 360 1.18e-9 PROSPERO
internal_repeat_1 323 439 3.7e-11 PROSPERO
low complexity region 441 472 N/A INTRINSIC
low complexity region 483 510 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
low complexity region 572 588 N/A INTRINSIC
Pfam:Collagen 603 673 6.6e-6 PFAM
Pfam:Collagen 627 694 5.4e-7 PFAM
Pfam:Collagen 660 734 3.2e-7 PFAM
Pfam:Collagen 711 770 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173749
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type XI collagen, one of the low abundance fibrillar collagens found in cartilage. The encoded protein, in association with other collagen subunits, forms a heterotrimeric type XI procollagen that may undergo proteolytic processing similar to the alpha-1 subunit. Mice lacking the encoded protein exhibit a mild phenotype similar to nonocular Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED) as well as a nonsyndromic form of deafness called DFNA13. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals exhibit reduced body size, short snout, a slightly bulged forehead, deafness, and disorganization of chondrocytes in the growth plate of long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,228,835 F2188L probably benign Het
Adam18 T A 8: 24,665,514 D163V probably benign Het
Ank2 A T 3: 126,947,298 probably benign Het
Ankmy1 T C 1: 92,886,720 E355G probably damaging Het
Ankmy2 A G 12: 36,182,492 N172S probably damaging Het
Ankrd50 A G 3: 38,456,082 M712T probably damaging Het
Apcdd1 T C 18: 62,937,034 I124T probably benign Het
Carmil3 A G 14: 55,494,890 K256R probably damaging Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Ccdc141 A G 2: 77,057,897 V508A probably benign Het
Ccdc33 A G 9: 58,117,167 S226P possibly damaging Het
Cep72 T C 13: 74,062,216 E9G probably benign Het
Clca4b A T 3: 144,915,466 Y616N probably damaging Het
Cnot4 A G 6: 35,078,004 S117P possibly damaging Het
Col4a4 T C 1: 82,487,517 E979G unknown Het
Coq10b T C 1: 55,064,200 Y46H possibly damaging Het
Dnah17 T C 11: 118,052,770 T3169A possibly damaging Het
Dock6 G A 9: 21,803,076 R1824* probably null Het
Dsp A C 13: 38,195,842 I1589L probably benign Het
Edil3 A G 13: 89,199,474 T383A probably benign Het
Efemp1 T C 11: 28,867,758 V79A probably damaging Het
Esyt1 C T 10: 128,519,460 V471I probably benign Het
Fbxo30 T C 10: 11,289,665 S44P possibly damaging Het
Fdx1l G T 9: 21,073,266 D57E probably benign Het
Gbp11 A T 5: 105,331,038 V178D probably damaging Het
Gm13084 G T 4: 143,812,599 S108* probably null Het
Gna11 A T 10: 81,531,133 I283N probably damaging Het
Grid2 A T 6: 63,503,361 Q53L probably benign Het
Jmjd6 A G 11: 116,840,426 S266P probably damaging Het
Kdelc1 C T 1: 44,112,677 V351M probably damaging Het
Kirrel G A 3: 87,090,518 R233C probably damaging Het
Kmt2d A G 15: 98,837,357 probably benign Het
Lama3 A T 18: 12,553,210 T1171S probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Med13 A T 11: 86,319,365 S650R probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mgat1 T C 11: 49,261,149 V153A probably benign Het
Mmp16 A T 4: 18,110,452 D416V probably damaging Het
Myh3 A T 11: 67,097,044 R1448W probably damaging Het
Nedd1 A T 10: 92,695,032 F398L probably benign Het
Olfr1009 T C 2: 85,721,987 I194T probably benign Het
Olfr1295 T C 2: 111,565,004 T147A probably benign Het
Olfr199 T C 16: 59,216,040 D191G probably benign Het
Olfr237-ps1 A G 6: 43,153,633 I109M probably benign Het
Otud3 A G 4: 138,897,583 L269P probably damaging Het
Otx1 A G 11: 21,996,296 probably benign Het
Pcdhga7 A C 18: 37,716,278 D446A probably damaging Het
Pcnx2 T G 8: 125,838,015 K1046N possibly damaging Het
Pfkp C A 13: 6,648,583 G33W probably damaging Het
Pold1 A G 7: 44,538,619 I585T probably damaging Het
Pole4 A G 6: 82,652,134 Y84H possibly damaging Het
Ptpn23 A G 9: 110,392,741 S126P possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rin3 T C 12: 102,387,632 L766P probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rras2 G A 7: 114,050,415 T138I possibly damaging Het
Scrn2 A G 11: 97,030,925 I74V probably benign Het
Sema6d T C 2: 124,659,815 I526T possibly damaging Het
Shd G T 17: 55,971,577 E47* probably null Het
Slc22a27 T C 19: 7,926,631 H47R probably damaging Het
Slc36a3 C G 11: 55,142,769 W141S possibly damaging Het
Slc9c1 T A 16: 45,556,614 V429E probably benign Het
Smg8 A T 11: 87,085,470 D428E probably benign Het
Snrpe A T 1: 133,606,473 F84Y probably benign Het
Tbc1d2b C T 9: 90,227,506 D306N possibly damaging Het
Trav9n-4 A G 14: 53,294,899 Y70C probably damaging Het
Ush1c A G 7: 46,221,423 I330T probably damaging Het
Wnt11 T C 7: 98,839,142 L12P probably damaging Het
Zan A G 5: 137,438,451 S2047P unknown Het
Zcchc6 A G 13: 59,788,553 F843L probably damaging Het
Zfp763 A C 17: 33,021,794 S20R probably damaging Het
Other mutations in Col11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Col11a2 APN 17 34061280 unclassified probably benign
IGL01839:Col11a2 APN 17 34064082 unclassified probably benign
IGL02429:Col11a2 APN 17 34042292 missense probably damaging 1.00
IGL02491:Col11a2 APN 17 34064207 unclassified probably benign
R0001:Col11a2 UTSW 17 34061612 missense probably benign 0.00
R0005:Col11a2 UTSW 17 34062879 unclassified probably benign
R0099:Col11a2 UTSW 17 34049674 missense probably damaging 0.99
R0106:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0243:Col11a2 UTSW 17 34062546 unclassified probably benign
R0254:Col11a2 UTSW 17 34064803 unclassified probably benign
R0352:Col11a2 UTSW 17 34042527 missense probably benign 0.43
R0362:Col11a2 UTSW 17 34062446 splice site probably null
R0491:Col11a2 UTSW 17 34042212 missense probably null 0.00
R0531:Col11a2 UTSW 17 34058377 splice site probably benign
R0538:Col11a2 UTSW 17 34051328 splice site probably benign
R0646:Col11a2 UTSW 17 34059348 critical splice donor site probably null
R0676:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0919:Col11a2 UTSW 17 34059150 missense possibly damaging 0.93
R1522:Col11a2 UTSW 17 34055254 missense probably damaging 1.00
R1767:Col11a2 UTSW 17 34063895 unclassified probably benign
R1872:Col11a2 UTSW 17 34062555 unclassified probably benign
R1941:Col11a2 UTSW 17 34044951 missense probably benign 0.01
R1945:Col11a2 UTSW 17 34059168 missense probably damaging 1.00
R2101:Col11a2 UTSW 17 34052169 missense probably damaging 1.00
R2161:Col11a2 UTSW 17 34064797 unclassified probably benign
R2258:Col11a2 UTSW 17 34039677 missense probably benign
R2259:Col11a2 UTSW 17 34039677 missense probably benign
R2260:Col11a2 UTSW 17 34039677 missense probably benign
R2761:Col11a2 UTSW 17 34051026 missense probably damaging 1.00
R3114:Col11a2 UTSW 17 34046468 missense possibly damaging 0.69
R3824:Col11a2 UTSW 17 34054180 missense probably damaging 1.00
R3938:Col11a2 UTSW 17 34039625 unclassified probably benign
R4039:Col11a2 UTSW 17 34045774 missense probably benign 0.00
R4675:Col11a2 UTSW 17 34064293 critical splice donor site probably null
R4810:Col11a2 UTSW 17 34057112 missense probably damaging 0.99
R4824:Col11a2 UTSW 17 34050963 missense probably damaging 1.00
R4944:Col11a2 UTSW 17 34042190 missense possibly damaging 0.47
R5112:Col11a2 UTSW 17 34064088 unclassified probably benign
R5355:Col11a2 UTSW 17 34051801 missense probably benign 0.07
R5384:Col11a2 UTSW 17 34059174 critical splice donor site probably null
R5860:Col11a2 UTSW 17 34064185 unclassified probably benign
R6252:Col11a2 UTSW 17 34042212 missense probably null 0.00
R6327:Col11a2 UTSW 17 34043317 missense probably benign 0.32
R6828:Col11a2 UTSW 17 34053633 splice site probably null
R6860:Col11a2 UTSW 17 34053598 missense probably damaging 1.00
R6873:Col11a2 UTSW 17 34065019 missense unknown
X0017:Col11a2 UTSW 17 34059985 critical splice donor site probably null
X0064:Col11a2 UTSW 17 34042247 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGAAGCCTCTGAGTGCTGTG -3'
(R):5'- TCACTCACCAATGGTCCAGG -3'

Sequencing Primer
(F):5'- CTCTGAGTGCTGTGCCAGAG -3'
(R):5'- AGGCAATGTGACAGAATCCC -3'
Posted On2016-10-24