Incidental Mutation 'R0179:Colec12'
ID43481
Institutional Source Beutler Lab
Gene Symbol Colec12
Ensembl Gene ENSMUSG00000036103
Gene Namecollectin sub-family member 12
SynonymsCL-P1, SRCL, Scara4
MMRRC Submission 038447-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R0179 (G1)
Quality Score147
Status Validated
Chromosome18
Chromosomal Location9707648-9877995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 9858921 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 568 (P568L)
Ref Sequence ENSEMBL: ENSMUSP00000043220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040069]
PDB Structure
Mouse Scavenger Receptor C-type Lectin carbohydrate-recognition domain. [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000040069
AA Change: P568L
SMART Domains Protein: ENSMUSP00000043220
Gene: ENSMUSG00000036103
AA Change: P568L

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 112 157 N/A INTRINSIC
low complexity region 205 211 N/A INTRINSIC
coiled coil region 217 247 N/A INTRINSIC
low complexity region 268 280 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
Pfam:Collagen 441 499 1.4e-10 PFAM
Pfam:Collagen 482 548 9.6e-10 PFAM
Pfam:Collagen 530 591 3.8e-11 PFAM
CLECT 607 731 4.19e-36 SMART
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. This protein is a scavenger receptor, a cell surface glycoprotein that displays several functions associated with host defense. It can bind to carbohydrate antigens on microorganisms, facilitating their recognition and removal. It also mediates the recognition, internalization, and degradation of oxidatively modified low density lipoprotein by vascular endothelial cells. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,214 S516P probably benign Het
4932431P20Rik A G 7: 29,535,940 noncoding transcript Het
Adamts1 C T 16: 85,795,465 S948N probably benign Het
Adck1 A T 12: 88,459,172 M457L possibly damaging Het
Adprm A T 11: 67,038,225 H313Q possibly damaging Het
Adssl1 T C 12: 112,632,269 I104T probably benign Het
Agxt2 A C 15: 10,399,048 Q435P possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Ankrd50 A G 3: 38,455,314 V968A possibly damaging Het
Brf2 T C 8: 27,125,868 D163G possibly damaging Het
Cd226 C A 18: 89,207,139 N53K probably benign Het
Cdc42ep2 T C 19: 5,918,608 D23G probably benign Het
Cdc7 T C 5: 106,965,039 S8P probably benign Het
Cdh8 C T 8: 99,111,712 E499K possibly damaging Het
Chd7 T A 4: 8,862,516 F2534L probably benign Het
Ckb T C 12: 111,670,176 T255A probably benign Het
Cntnap5c G T 17: 57,769,625 W19L probably benign Het
Cntrl A G 2: 35,167,859 E1854G probably benign Het
Cop1 A G 1: 159,250,066 D157G probably benign Het
Csf2rb A C 15: 78,336,372 Q38P possibly damaging Het
Ctla2b T C 13: 60,896,293 D52G possibly damaging Het
Dcaf7 A T 11: 106,051,797 D190V probably damaging Het
Depdc5 T A 5: 32,901,574 probably benign Het
Dgkq A G 5: 108,658,200 probably benign Het
Dhrs2 A G 14: 55,240,476 T222A probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
E4f1 G C 17: 24,451,437 T92S possibly damaging Het
Ep400 A T 5: 110,668,649 S2669T probably damaging Het
Eprs T G 1: 185,413,547 D1184E probably benign Het
Fpr-rs4 A T 17: 18,022,027 K99* probably null Het
Fzr1 A T 10: 81,369,070 probably benign Het
Gcc2 C T 10: 58,276,650 R1001C probably benign Het
Gm4884 A G 7: 41,043,828 D407G probably benign Het
Golga4 A T 9: 118,560,740 probably null Het
Gp2 T G 7: 119,452,317 D225A possibly damaging Het
Gramd1a T A 7: 31,142,418 T120S probably damaging Het
Hbb-bh2 T A 7: 103,839,227 N121I probably benign Het
Htr6 A T 4: 139,062,126 L276Q probably damaging Het
Itga9 A T 9: 118,661,386 I262F probably benign Het
Lamc3 A G 2: 31,915,084 probably benign Het
Large1 T C 8: 73,098,846 N200S probably benign Het
Lct C T 1: 128,327,685 V207I probably benign Het
Marf1 C A 16: 14,151,176 L144F probably damaging Het
Morc2b A T 17: 33,136,982 Y605* probably null Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Muc2 A G 7: 141,748,971 Y17C probably damaging Het
Myf5 T C 10: 107,485,918 D5G possibly damaging Het
Nasp C T 4: 116,602,157 V375M probably damaging Het
Nr1h2 A T 7: 44,552,265 probably null Het
Nrg2 T C 18: 36,022,415 Q447R probably benign Het
Ntn5 G A 7: 45,686,313 G56D probably damaging Het
Oasl2 A G 5: 114,910,912 R138G probably benign Het
Olfr1209 A T 2: 88,909,893 C167S possibly damaging Het
Olfr1489 T A 19: 13,633,140 F10I probably damaging Het
Olfr827 T C 10: 130,210,338 Y264C probably damaging Het
Pcdhb5 G A 18: 37,322,559 G664D probably damaging Het
Ppp1r15a T C 7: 45,525,000 E128G probably damaging Het
Prpf19 T C 19: 10,897,808 probably benign Het
Ptpn3 T A 4: 57,270,118 T15S probably benign Het
R3hdm2 G A 10: 127,495,106 C818Y probably damaging Het
Rad51d A G 11: 82,889,998 V39A possibly damaging Het
Rptor A T 11: 119,872,367 T926S probably benign Het
Rwdd4a G A 8: 47,542,707 D41N probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Ssbp3 T C 4: 107,046,388 S334P probably damaging Het
Suco A G 1: 161,876,305 probably benign Het
Synj1 T C 16: 90,964,631 K649R possibly damaging Het
Tdp2 C T 13: 24,840,448 H243Y possibly damaging Het
Tinag A G 9: 76,996,882 probably benign Het
Trerf1 T C 17: 47,316,662 noncoding transcript Het
Trip10 T C 17: 57,262,349 probably benign Het
Tsen54 A T 11: 115,822,030 S131C probably damaging Het
Unc5c A T 3: 141,818,067 R794* probably null Het
Vmn2r59 A T 7: 42,047,008 Y103* probably null Het
Washc5 A G 15: 59,352,530 V460A probably benign Het
Whamm A G 7: 81,594,015 T358A probably benign Het
Xlr4b C T X: 73,218,671 probably benign Het
Zbbx C T 3: 75,085,562 probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp27 T A 7: 29,896,425 E38D possibly damaging Het
Other mutations in Colec12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Colec12 APN 18 9848826 missense probably damaging 1.00
IGL02477:Colec12 APN 18 9859858 missense unknown
R0128:Colec12 UTSW 18 9858921 missense unknown
R0130:Colec12 UTSW 18 9858921 missense unknown
R0178:Colec12 UTSW 18 9858921 missense unknown
R0180:Colec12 UTSW 18 9858921 missense unknown
R0180:Colec12 UTSW 18 9848890 missense probably damaging 0.99
R0318:Colec12 UTSW 18 9848446 missense possibly damaging 0.77
R0344:Colec12 UTSW 18 9858921 missense unknown
R0573:Colec12 UTSW 18 9858650 missense probably damaging 0.97
R1028:Colec12 UTSW 18 9866837 missense unknown
R1693:Colec12 UTSW 18 9866765 missense unknown
R1951:Colec12 UTSW 18 9859975 critical splice donor site probably null
R2008:Colec12 UTSW 18 9874813 missense probably benign 0.03
R2181:Colec12 UTSW 18 9846828 missense probably damaging 0.99
R4258:Colec12 UTSW 18 9720950 missense probably damaging 1.00
R4794:Colec12 UTSW 18 9848984 missense probably damaging 0.99
R5269:Colec12 UTSW 18 9846825 missense possibly damaging 0.67
R5369:Colec12 UTSW 18 9866750 missense unknown
R5421:Colec12 UTSW 18 9858580 missense probably damaging 1.00
R5608:Colec12 UTSW 18 9848267 missense possibly damaging 0.95
R5668:Colec12 UTSW 18 9848963 missense probably damaging 1.00
R5684:Colec12 UTSW 18 9849009 missense probably damaging 0.99
R6547:Colec12 UTSW 18 9840351 missense probably damaging 1.00
R7194:Colec12 UTSW 18 9848248 missense probably benign 0.08
R7253:Colec12 UTSW 18 9848922 missense probably damaging 1.00
Z1088:Colec12 UTSW 18 9848727 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACCTGGTCCAACTGGCAACAAG -3'
(R):5'- GCCAAGCCTACACACTGCCTTATTC -3'

Sequencing Primer
(F):5'- GGCACAATTGGACCAGTCG -3'
(R):5'- TTCCTCCACAATTCTAGCTGAGAAG -3'
Posted On2013-05-24