Incidental Mutation 'R5536:Mthfr'
ID434818
Institutional Source Beutler Lab
Gene Symbol Mthfr
Ensembl Gene ENSMUSG00000029009
Gene Namemethylenetetrahydrofolate reductase
Synonyms
MMRRC Submission 043094-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R5536 (G1)
Quality Score93
Status Not validated
Chromosome4
Chromosomal Location148039077-148059551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148044483 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 171 (F171S)
Ref Sequence ENSEMBL: ENSMUSP00000095395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069604] [ENSMUST00000097788] [ENSMUST00000141283] [ENSMUST00000152498]
Predicted Effect probably damaging
Transcript: ENSMUST00000069604
AA Change: F212S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069774
Gene: ENSMUSG00000029009
AA Change: F212S

DomainStartEndE-ValueType
low complexity region 48 73 N/A INTRINSIC
Pfam:MTHFR 88 377 2.3e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097788
AA Change: F171S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095395
Gene: ENSMUSG00000029009
AA Change: F171S

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
Pfam:MTHFR 47 336 5.9e-121 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125978
Predicted Effect probably damaging
Transcript: ENSMUST00000141283
AA Change: F171S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116239
Gene: ENSMUSG00000029009
AA Change: F171S

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
Pfam:MTHFR 47 194 7.4e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145115
Predicted Effect probably damaging
Transcript: ENSMUST00000152498
AA Change: F187S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117095
Gene: ENSMUSG00000029009
AA Change: F187S

DomainStartEndE-ValueType
low complexity region 23 48 N/A INTRINSIC
Pfam:MTHFR 63 352 2.4e-121 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine. Genetic variation in this gene influences susceptibility to occlusive vascular disease, neural tube defects, colon cancer and acute leukemia, and mutations in this gene are associated with methylenetetrahydrofolate reductase deficiency.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have elevated plasma levels of homocysteine. They also display delayed growth and development and a reduced survival rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,066,388 G446V possibly damaging Het
Aadac T G 3: 60,039,563 N227K probably benign Het
Acap1 C T 11: 69,889,307 G74R probably benign Het
Adrm1 A G 2: 180,172,188 probably benign Het
Appl1 G C 14: 26,923,780 S691* probably null Het
Atp2a2 T C 5: 122,457,182 D1035G probably benign Het
AW551984 A G 9: 39,592,873 I599T probably benign Het
Col23a1 C A 11: 51,567,949 D304E probably damaging Het
Csmd1 T C 8: 16,288,660 R478G probably damaging Het
Dnah7a T C 1: 53,425,253 N3660D probably benign Het
Drosha T A 15: 12,929,711 Y1331N possibly damaging Het
E2f6 T G 12: 16,824,684 S256A probably benign Het
Evc A G 5: 37,326,583 probably benign Het
Fsip2 A T 2: 82,987,059 I4379F probably benign Het
Galnt2 T C 8: 124,323,673 C91R probably damaging Het
Gm3095 G T 14: 3,964,502 M73I probably benign Het
Gpr179 T A 11: 97,343,815 Q480L probably damaging Het
Gucy2g T A 19: 55,237,927 I186F probably benign Het
Hmcn1 T A 1: 150,755,291 I919F probably benign Het
Kdm3a A C 6: 71,611,936 V363G probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lama5 C T 2: 180,189,349 R1839H probably damaging Het
Lpo T C 11: 87,816,563 D208G probably damaging Het
Lpp A G 16: 24,845,206 D411G possibly damaging Het
Marco T C 1: 120,504,735 S8G possibly damaging Het
Nlrx1 A T 9: 44,263,886 S198T probably damaging Het
Nol10 C A 12: 17,416,137 S511* probably null Het
Nup153 T C 13: 46,683,009 T1375A probably benign Het
Obscn A G 11: 59,107,871 S1367P probably damaging Het
Olfr1269 A G 2: 90,118,839 V253A probably benign Het
Pcdha7 G A 18: 36,975,250 V443M probably damaging Het
Plekha1 G T 7: 130,909,601 R305I probably damaging Het
Psmb2 T A 4: 126,684,209 I60N probably damaging Het
Rad17 C A 13: 100,631,104 G330C probably damaging Het
Slc5a6 A G 5: 31,043,102 S80P probably damaging Het
Srgap2 T A 1: 131,300,390 probably null Het
Taf8 C A 17: 47,494,482 R164L possibly damaging Het
Tmem87a C A 2: 120,397,430 D79Y probably damaging Het
Tmtc4 G A 14: 122,932,879 R574W probably benign Het
Tprn G A 2: 25,263,357 A224T probably benign Het
Usf3 A G 16: 44,217,370 T738A probably benign Het
Vmn2r54 A C 7: 12,632,416 V197G probably benign Het
Zbtb40 G T 4: 136,987,331 P1049Q probably damaging Het
Zfp551 A T 7: 12,415,561 S640R possibly damaging Het
Zfp932 T A 5: 110,009,847 C470* probably null Het
Zkscan8 T C 13: 21,526,668 I91V probably damaging Het
Zmat4 T C 8: 23,748,492 V30A probably damaging Het
Other mutations in Mthfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Mthfr APN 4 148041270 missense probably benign
IGL00911:Mthfr APN 4 148041302 missense probably benign 0.01
R0116:Mthfr UTSW 4 148051523 missense probably benign 0.00
R0207:Mthfr UTSW 4 148052224 missense probably damaging 1.00
R0268:Mthfr UTSW 4 148055428 missense probably damaging 1.00
R0344:Mthfr UTSW 4 148055428 missense probably damaging 1.00
R0762:Mthfr UTSW 4 148055443 missense possibly damaging 0.65
R1433:Mthfr UTSW 4 148055443 missense possibly damaging 0.92
R1464:Mthfr UTSW 4 148053572 splice site probably benign
R1972:Mthfr UTSW 4 148051927 missense probably damaging 1.00
R3154:Mthfr UTSW 4 148051604 missense probably benign 0.12
R3407:Mthfr UTSW 4 148055061 missense probably damaging 1.00
R3773:Mthfr UTSW 4 148044450 missense probably benign 0.00
R4153:Mthfr UTSW 4 148051475 missense probably damaging 0.99
R4291:Mthfr UTSW 4 148055492 missense probably damaging 1.00
R4487:Mthfr UTSW 4 148051427 missense probably benign 0.00
R4574:Mthfr UTSW 4 148043541 missense possibly damaging 0.95
R4583:Mthfr UTSW 4 148051872 missense possibly damaging 0.80
R4847:Mthfr UTSW 4 148048139 missense probably damaging 0.99
R5183:Mthfr UTSW 4 148051360 splice site probably null
R5664:Mthfr UTSW 4 148055466 missense probably damaging 1.00
R6161:Mthfr UTSW 4 148041754 missense probably benign 0.35
R7285:Mthfr UTSW 4 148053599 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGACAACTGACCACTGCC -3'
(R):5'- GGTGCCATTCAGTTCACCTC -3'

Sequencing Primer
(F):5'- TCCTACTTGCCAGGTGCCAG -3'
(R):5'- GCCATTCAGTTCACCTCTGTGTC -3'
Posted On2016-10-24