Incidental Mutation 'R5537:Brinp2'
ID434855
Institutional Source Beutler Lab
Gene Symbol Brinp2
Ensembl Gene ENSMUSG00000004031
Gene Namebone morphogenic protein/retinoic acid inducible neural-specific 2
Synonyms6430517E21Rik, Fam5b
MMRRC Submission 043095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5537 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location158245269-158356326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 158255013 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 246 (V246I)
Ref Sequence ENSEMBL: ENSMUSP00000004133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004133] [ENSMUST00000195271]
Predicted Effect probably damaging
Transcript: ENSMUST00000004133
AA Change: V246I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004133
Gene: ENSMUSG00000004031
AA Change: V246I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
MACPF 89 281 6.58e-50 SMART
Blast:MACPF 338 362 1e-5 BLAST
EGF 457 492 6.92e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195271
SMART Domains Protein: ENSMUSP00000141709
Gene: ENSMUSG00000004031

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:MACPF 63 160 2.1e-6 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,955,485 I1123F probably damaging Het
Acsl3 C T 1: 78,706,356 R702C probably damaging Het
Ank1 A G 8: 23,114,876 E1031G probably damaging Het
Ankle2 T C 5: 110,249,495 S536P probably damaging Het
Arfgef2 G T 2: 166,856,593 probably null Het
Bahd1 G T 2: 118,915,980 D27Y probably damaging Het
Ccdc187 C A 2: 26,276,225 A731S probably benign Het
Cdc37l1 T A 19: 28,995,118 N70K probably damaging Het
Cdk5r1 A G 11: 80,477,999 Y164C probably damaging Het
Clrn3 A T 7: 135,514,062 H186Q probably benign Het
Col12a1 G A 9: 79,699,590 T517I probably damaging Het
Crhr1 T A 11: 104,163,856 N98K possibly damaging Het
Dst C T 1: 34,189,878 S2362L probably benign Het
Eapp G A 12: 54,692,059 T98I probably benign Het
Gm8394 A G 10: 85,314,049 noncoding transcript Het
Iqsec3 T C 6: 121,412,644 probably benign Het
Kctd12 A G 14: 102,982,277 V55A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lgr5 T C 10: 115,456,689 D432G probably benign Het
Mrgprx1 T A 7: 48,021,150 H283L probably benign Het
Nlrp4e T C 7: 23,320,489 F134L probably benign Het
Olfr1030 T A 2: 85,984,226 Y129N possibly damaging Het
Olfr1307 A T 2: 111,945,048 M136K probably damaging Het
Olfr394 T C 11: 73,887,697 K225R probably benign Het
Olfr902 T A 9: 38,449,242 Y123* probably null Het
Pfkp C A 13: 6,619,242 W235L probably damaging Het
Prom1 C T 5: 44,000,776 probably null Het
Rab14 A T 2: 35,192,637 F12L possibly damaging Het
Rnf40 T A 7: 127,596,089 I429N probably benign Het
S100pbp G A 4: 129,182,188 P115S probably benign Het
Scarf1 G A 11: 75,525,531 A600T probably damaging Het
Slc6a5 T C 7: 49,959,311 F755L probably benign Het
Slc7a2 A T 8: 40,913,986 I510F probably benign Het
Spag16 T C 1: 69,827,016 S5P probably benign Het
Tex15 A G 8: 33,571,613 Y631C probably damaging Het
Tmem182 A T 1: 40,854,909 I195F probably benign Het
Tox A G 4: 6,697,510 L431P probably damaging Het
Tprn G A 2: 25,263,357 A224T probably benign Het
Tsg101 T C 7: 46,891,128 K294E probably benign Het
Tubb2a C A 13: 34,075,451 V119L probably benign Het
Vps37d C T 5: 135,074,402 E129K possibly damaging Het
Zfp974 TAATCTGTCTCCAAATCTG TAATCTG 7: 27,912,246 probably benign Het
Zpld1 A G 16: 55,233,640 V263A possibly damaging Het
Other mutations in Brinp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Brinp2 APN 1 158247100 missense probably benign 0.04
IGL01537:Brinp2 APN 1 158246809 missense probably damaging 1.00
IGL02354:Brinp2 APN 1 158247178 missense probably damaging 1.00
IGL02361:Brinp2 APN 1 158247178 missense probably damaging 1.00
R0334:Brinp2 UTSW 1 158295585 missense probably benign 0.06
R0652:Brinp2 UTSW 1 158246621 missense probably damaging 1.00
R1017:Brinp2 UTSW 1 158249451 missense probably damaging 0.99
R1141:Brinp2 UTSW 1 158247270 missense probably damaging 0.99
R1378:Brinp2 UTSW 1 158247054 missense possibly damaging 0.82
R1666:Brinp2 UTSW 1 158246558 missense probably damaging 1.00
R1892:Brinp2 UTSW 1 158254972 critical splice donor site probably null
R1986:Brinp2 UTSW 1 158246778 missense probably damaging 1.00
R3876:Brinp2 UTSW 1 158246846 missense probably damaging 0.99
R3924:Brinp2 UTSW 1 158246208 missense probably damaging 1.00
R4582:Brinp2 UTSW 1 158267938 missense probably damaging 1.00
R5239:Brinp2 UTSW 1 158251338 missense probably benign 0.00
R5582:Brinp2 UTSW 1 158249409 missense probably damaging 1.00
R5762:Brinp2 UTSW 1 158246586 missense probably benign
R5922:Brinp2 UTSW 1 158249355 missense possibly damaging 0.79
R6746:Brinp2 UTSW 1 158266590 missense probably benign
R6999:Brinp2 UTSW 1 158251305 missense probably benign 0.20
R7144:Brinp2 UTSW 1 158295424 critical splice donor site probably null
R7221:Brinp2 UTSW 1 158266547 missense possibly damaging 0.90
R7376:Brinp2 UTSW 1 158251368 missense probably damaging 0.98
R7381:Brinp2 UTSW 1 158246343 missense probably benign 0.11
R7388:Brinp2 UTSW 1 158255009 missense probably damaging 1.00
X0024:Brinp2 UTSW 1 158267983 nonsense probably null
Z1088:Brinp2 UTSW 1 158246989 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATACTCTCAAGGGGAGGCCAAG -3'
(R):5'- TCACTTCAGATTCCTATGAGATGC -3'

Sequencing Primer
(F):5'- GAGCCTGGACACAGCCATC -3'
(R):5'- GCAAATGCAGTTCCTTAGGTCAG -3'
Posted On2016-10-24