Mutagenetix > Incidental Mutation

Incidental Mutation 'R5537:Cdk5r1'

434889

Institutional Source

Beutler Lab

Gene Symbol

Cdk5r1

Ensembl Gene

ENSMUSG00000048895

Gene Name

cyclin dependent kinase 5, regulatory subunit 1

Synonyms

p25, p35, D11Bwg0379e

MMRRC Submission

043095-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.710) question?

Stock #

R5537 (G1)

Quality Score

154

Status

Not validated

Chromosome

Chromosomal Location

80367849-80372010 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80368825 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 164 (Y164C)

Ref Sequence

ENSEMBL: ENSMUSP00000099514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017572] [ENSMUST00000041065] [ENSMUST00000053413] [ENSMUST00000147694]

AlphaFold

P61809

Predicted Effect

probably benign
Transcript: ENSMUST00000017572

SMART Domains

Protein: ENSMUSP00000017572
Gene: ENSMUSG00000017428

Domain	Start	End	E-Value	Type
PAM	143	320	1.6e-67	SMART
PINT	321	404	4.34e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000041065

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000053413
AA Change: Y164C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099514
Gene: ENSMUSG00000048895
AA Change: Y164C

Domain	Start	End	E-Value	Type
Pfam:CDK5_activator	69	294	1.6e-100	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147694

SMART Domains

Protein: ENSMUSP00000120964
Gene: ENSMUSG00000048895

Domain	Start	End	E-Value	Type
Pfam:CDK5_activator	1	138	2.3e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173797

SMART Domains

Protein: ENSMUSP00000133739
Gene: ENSMUSG00000017428

Domain	Start	End	E-Value	Type
Blast:PAM	2	58	9e-33	BLAST
PINT	59	142	4.34e-23	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene (p35) is a neuron-specific activator of cyclin-dependent kinase 5 (CDK5); the activation of CDK5 is required for proper development of the central nervous system. The p35 form of this protein is proteolytically cleaved by calpain, generating a p25 form. The cleavage of p35 into p25 results in relocalization of the protein from the cell periphery to nuclear and perinuclear regions. P25 deregulates CDK5 activity by prolonging its activation and changing its cellular location. The p25 form accumulates in the brain neurons of patients with Alzheimer's disease. This accumulation correlates with an increase in CDK5 kinase activity, and may lead to aberrantly phosphorylated forms of the microtubule-associated protein tau, which contributes to Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of the gene results in structural abnormalities of the brain such as a small corpus callosum and delaminated cerebral cortex. Mice show hyperactivity and decreased locomotion in response to stimulants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	T	5: 9,005,485 (GRCm39)	I1123F	probably damaging	Het
Acsl3	C	T	1: 78,684,073 (GRCm39)	R702C	probably damaging	Het
Ank1	A	G	8: 23,604,892 (GRCm39)	E1031G	probably damaging	Het
Ankle2	T	C	5: 110,397,361 (GRCm39)	S536P	probably damaging	Het
Arfgef2	G	T	2: 166,698,513 (GRCm39)		probably null	Het
Bahd1	G	T	2: 118,746,461 (GRCm39)	D27Y	probably damaging	Het
Brinp2	C	T	1: 158,082,583 (GRCm39)	V246I	probably damaging	Het
Ccdc187	C	A	2: 26,166,237 (GRCm39)	A731S	probably benign	Het
Cdc37l1	T	A	19: 28,972,518 (GRCm39)	N70K	probably damaging	Het
Clrn3	A	T	7: 135,115,791 (GRCm39)	H186Q	probably benign	Het
Col12a1	G	A	9: 79,606,872 (GRCm39)	T517I	probably damaging	Het
Crhr1	T	A	11: 104,054,682 (GRCm39)	N98K	possibly damaging	Het
Dst	C	T	1: 34,228,959 (GRCm39)	S2362L	probably benign	Het
Eapp	G	A	12: 54,738,844 (GRCm39)	T98I	probably benign	Het
Iqsec3	T	C	6: 121,389,603 (GRCm39)		probably benign	Het
Kctd12	A	G	14: 103,219,713 (GRCm39)	V55A	probably benign	Het
Kmt2d	G	A	15: 98,749,990 (GRCm39)		probably benign	Het
Lgr5	T	C	10: 115,292,594 (GRCm39)	D432G	probably benign	Het
Mrgprx1	T	A	7: 47,670,898 (GRCm39)	H283L	probably benign	Het
Nlrp4e	T	C	7: 23,019,914 (GRCm39)	F134L	probably benign	Het
Or1e34	T	C	11: 73,778,523 (GRCm39)	K225R	probably benign	Het
Or4f14b	A	T	2: 111,775,393 (GRCm39)	M136K	probably damaging	Het
Or5m5	T	A	2: 85,814,570 (GRCm39)	Y129N	possibly damaging	Het
Or8b43	T	A	9: 38,360,538 (GRCm39)	Y123*	probably null	Het
Pfkp	C	A	13: 6,669,278 (GRCm39)	W235L	probably damaging	Het
Prom1	C	T	5: 44,158,118 (GRCm39)		probably null	Het
Psma5-ps	A	G	10: 85,149,913 (GRCm39)		noncoding transcript	Het
Rab14	A	T	2: 35,082,649 (GRCm39)	F12L	possibly damaging	Het
Rnf40	T	A	7: 127,195,261 (GRCm39)	I429N	probably benign	Het
S100pbp	G	A	4: 129,075,981 (GRCm39)	P115S	probably benign	Het
Scarf1	G	A	11: 75,416,357 (GRCm39)	A600T	probably damaging	Het
Slc6a5	T	C	7: 49,609,059 (GRCm39)	F755L	probably benign	Het
Slc7a2	A	T	8: 41,367,023 (GRCm39)	I510F	probably benign	Het
Spag16	T	C	1: 69,866,175 (GRCm39)	S5P	probably benign	Het
Tex15	A	G	8: 34,061,641 (GRCm39)	Y631C	probably damaging	Het
Tmem182	A	T	1: 40,894,069 (GRCm39)	I195F	probably benign	Het
Tox	A	G	4: 6,697,510 (GRCm39)	L431P	probably damaging	Het
Tprn	G	A	2: 25,153,369 (GRCm39)	A224T	probably benign	Het
Tsg101	T	C	7: 46,540,876 (GRCm39)	K294E	probably benign	Het
Tubb2a	C	A	13: 34,259,434 (GRCm39)	V119L	probably benign	Het
Vps37d	C	T	5: 135,103,256 (GRCm39)	E129K	possibly damaging	Het
Zfp974	TAATCTGTCTCCAAATCTG	TAATCTG	7: 27,611,671 (GRCm39)		probably benign	Het
Zpld1	A	G	16: 55,054,003 (GRCm39)	V263A	possibly damaging	Het

Other mutations in Cdk5r1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02450:Cdk5r1	APN	11	80,368,666 (GRCm39)	missense	probably benign	0.09
IGL02754:Cdk5r1	APN	11	80,368,569 (GRCm39)	missense	probably benign	0.00
R0230:Cdk5r1	UTSW	11	80,368,576 (GRCm39)	missense	probably damaging	1.00
R4166:Cdk5r1	UTSW	11	80,369,035 (GRCm39)	missense	probably damaging	1.00
R5926:Cdk5r1	UTSW	11	80,369,128 (GRCm39)	splice site	probably null
R6350:Cdk5r1	UTSW	11	80,369,068 (GRCm39)	missense	probably damaging	1.00
R6841:Cdk5r1	UTSW	11	80,369,021 (GRCm39)	nonsense	probably null
R7542:Cdk5r1	UTSW	11	80,369,190 (GRCm39)	missense	probably damaging	1.00
R9612:Cdk5r1	UTSW	11	80,368,480 (GRCm39)	missense	probably benign	0.00
R9768:Cdk5r1	UTSW	11	80,368,414 (GRCm39)	missense	probably damaging	1.00
T0722:Cdk5r1	UTSW	11	80,368,707 (GRCm39)	missense	probably benign	0.38

Predicted Primers

PCR Primer
(F):5'- TGCCAACCTGTCCACATTCG -3'
(R):5'- TACAGACAGGTCAGCAGGAC -3'

Sequencing Primer
(F):5'- GTCCACATTCGCCCAGC -3'
(R):5'- ATCCCTGCAGAGCATGTA -3'

Posted On

2016-10-24