Incidental Mutation 'R5538:Usp32'
ID434946
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
MMRRC Submission 043096-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.771) question?
Stock #R5538 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85017786 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1031 (D1031E)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108075
AA Change: D1031E

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: D1031E

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (73/78)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik T A 18: 40,257,266 Y97* probably null Het
4930467E23Rik A C 8: 19,749,414 probably null Het
Adgrv1 C A 13: 81,433,689 R4745S probably benign Het
Ank3 A G 10: 69,987,427 E642G probably damaging Het
Arhgap11a G T 2: 113,837,530 D375E probably benign Het
Arl8b C A 6: 108,783,336 L28M probably damaging Het
Bbs2 G A 8: 94,089,763 T157M probably damaging Het
C2cd3 T A 7: 100,455,493 probably null Het
C6 T A 15: 4,814,829 I911N possibly damaging Het
Cc2d2a T C 5: 43,695,176 I365T possibly damaging Het
Cd46 T G 1: 195,068,170 probably null Het
Ceacam3 A T 7: 17,158,421 D363V probably damaging Het
Cep63 A T 9: 102,588,793 L678* probably null Het
Clasrp A C 7: 19,584,782 probably benign Het
Clk2 T A 3: 89,175,655 Y412N probably damaging Het
Col24a1 C T 3: 145,293,121 A5V probably damaging Het
Cox16 T C 12: 81,484,929 N13D possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx32 A T 7: 133,723,217 M437K probably benign Het
Dnm2 T C 9: 21,505,627 F819L probably benign Het
Dpysl4 A G 7: 139,091,990 T85A probably benign Het
Dspp A T 5: 104,175,230 K80* probably null Het
Dync2h1 T C 9: 7,168,630 probably benign Het
Ern1 A G 11: 106,421,901 V218A possibly damaging Het
Fbn2 G A 18: 58,071,901 R1157C probably benign Het
Fez1 T A 9: 36,868,876 I323N probably damaging Het
Fmo9 T A 1: 166,673,629 T199S probably benign Het
Fry T A 5: 150,495,848 L915Q probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gnpda2 A T 5: 69,578,051 H230Q probably damaging Het
Gramd1c T A 16: 43,982,092 N652I probably damaging Het
H2-Bl T A 17: 36,081,286 H178L probably benign Het
Hells T A 19: 38,953,652 F462Y probably benign Het
Htr7 A G 19: 35,969,835 F260L probably benign Het
Itsn1 C A 16: 91,784,102 A23D probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Kif20b A T 19: 34,952,964 K25* probably null Het
Klf2 T C 8: 72,319,472 L40P probably damaging Het
Kmt2a A G 9: 44,820,342 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lonrf1 T A 8: 36,223,024 probably null Het
Lrp1b A T 2: 40,697,474 I154K unknown Het
Mybpc1 T A 10: 88,546,029 I600L possibly damaging Het
Npnt T C 3: 132,904,963 N285S probably damaging Het
Olfr1255 T A 2: 89,816,620 F92Y probably damaging Het
Olfr429 T C 1: 174,089,978 *313R probably null Het
Olfr572 A G 7: 102,928,521 T298A probably damaging Het
Olfr816 T A 10: 129,912,002 Y92F probably benign Het
Pcnx T C 12: 81,860,409 V13A probably damaging Het
Pddc1 A G 7: 141,406,845 probably benign Het
Phkb G A 8: 85,922,127 V191I possibly damaging Het
Pnpla6 A G 8: 3,531,508 M594V probably benign Het
Prkdc A G 16: 15,651,469 E146G probably damaging Het
Ror1 T C 4: 100,441,011 M527T probably benign Het
Scnm1 A G 3: 95,129,755 probably benign Het
Skint11 A T 4: 114,231,762 N251I probably damaging Het
Slc19a3 T A 1: 83,022,561 N245I possibly damaging Het
Slc1a3 A T 15: 8,645,704 D272E probably damaging Het
Smok2b T A 17: 13,235,553 V200D possibly damaging Het
Sspo T C 6: 48,452,178 Y417H probably damaging Het
Stk11ip C A 1: 75,528,335 S388R probably damaging Het
Svep1 T C 4: 58,049,282 probably null Het
Sytl2 A G 7: 90,388,906 I525V probably benign Het
Tie1 T C 4: 118,486,193 N158D probably benign Het
Tle2 T C 10: 81,580,584 L180P probably damaging Het
Txlnb T C 10: 17,838,909 L363P probably damaging Het
Upk3b C G 5: 136,044,036 A258G probably benign Het
Vmn2r116 C T 17: 23,401,067 L592F probably benign Het
Zfp607b A G 7: 27,702,869 H250R probably damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTGCATTTCACCAATGAGGG -3'
(R):5'- AGAATTACTTGGTCTATGCCTTCTC -3'

Sequencing Primer
(F):5'- TTTCACCAATGAGGGCTGAC -3'
(R):5'- CTCTGTCCTGAAAGTCAACCCTG -3'
Posted On2016-10-24