Incidental Mutation 'R5538:Fbn2'
ID434960
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Namefibrillin 2
SynonymsFib-2, sy, Sne
MMRRC Submission 043096-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R5538 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location58008623-58209926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58071901 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1157 (R1157C)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
Predicted Effect probably benign
Transcript: ENSMUST00000025497
AA Change: R1157C

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: R1157C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik T A 18: 40,257,266 Y97* probably null Het
4930467E23Rik A C 8: 19,749,414 probably null Het
Adgrv1 C A 13: 81,433,689 R4745S probably benign Het
Ank3 A G 10: 69,987,427 E642G probably damaging Het
Arhgap11a G T 2: 113,837,530 D375E probably benign Het
Arl8b C A 6: 108,783,336 L28M probably damaging Het
Bbs2 G A 8: 94,089,763 T157M probably damaging Het
C2cd3 T A 7: 100,455,493 probably null Het
C6 T A 15: 4,814,829 I911N possibly damaging Het
Cc2d2a T C 5: 43,695,176 I365T possibly damaging Het
Cd46 T G 1: 195,068,170 probably null Het
Ceacam3 A T 7: 17,158,421 D363V probably damaging Het
Cep63 A T 9: 102,588,793 L678* probably null Het
Clasrp A C 7: 19,584,782 probably benign Het
Clk2 T A 3: 89,175,655 Y412N probably damaging Het
Col24a1 C T 3: 145,293,121 A5V probably damaging Het
Cox16 T C 12: 81,484,929 N13D possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx32 A T 7: 133,723,217 M437K probably benign Het
Dnm2 T C 9: 21,505,627 F819L probably benign Het
Dpysl4 A G 7: 139,091,990 T85A probably benign Het
Dspp A T 5: 104,175,230 K80* probably null Het
Dync2h1 T C 9: 7,168,630 probably benign Het
Ern1 A G 11: 106,421,901 V218A possibly damaging Het
Fez1 T A 9: 36,868,876 I323N probably damaging Het
Fmo9 T A 1: 166,673,629 T199S probably benign Het
Fry T A 5: 150,495,848 L915Q probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gnpda2 A T 5: 69,578,051 H230Q probably damaging Het
Gramd1c T A 16: 43,982,092 N652I probably damaging Het
H2-Bl T A 17: 36,081,286 H178L probably benign Het
Hells T A 19: 38,953,652 F462Y probably benign Het
Htr7 A G 19: 35,969,835 F260L probably benign Het
Itsn1 C A 16: 91,784,102 A23D probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Kif20b A T 19: 34,952,964 K25* probably null Het
Klf2 T C 8: 72,319,472 L40P probably damaging Het
Kmt2a A G 9: 44,820,342 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lonrf1 T A 8: 36,223,024 probably null Het
Lrp1b A T 2: 40,697,474 I154K unknown Het
Mybpc1 T A 10: 88,546,029 I600L possibly damaging Het
Npnt T C 3: 132,904,963 N285S probably damaging Het
Olfr1255 T A 2: 89,816,620 F92Y probably damaging Het
Olfr429 T C 1: 174,089,978 *313R probably null Het
Olfr572 A G 7: 102,928,521 T298A probably damaging Het
Olfr816 T A 10: 129,912,002 Y92F probably benign Het
Pcnx T C 12: 81,860,409 V13A probably damaging Het
Pddc1 A G 7: 141,406,845 probably benign Het
Phkb G A 8: 85,922,127 V191I possibly damaging Het
Pnpla6 A G 8: 3,531,508 M594V probably benign Het
Prkdc A G 16: 15,651,469 E146G probably damaging Het
Ror1 T C 4: 100,441,011 M527T probably benign Het
Scnm1 A G 3: 95,129,755 probably benign Het
Skint11 A T 4: 114,231,762 N251I probably damaging Het
Slc19a3 T A 1: 83,022,561 N245I possibly damaging Het
Slc1a3 A T 15: 8,645,704 D272E probably damaging Het
Smok2b T A 17: 13,235,553 V200D possibly damaging Het
Sspo T C 6: 48,452,178 Y417H probably damaging Het
Stk11ip C A 1: 75,528,335 S388R probably damaging Het
Svep1 T C 4: 58,049,282 probably null Het
Sytl2 A G 7: 90,388,906 I525V probably benign Het
Tie1 T C 4: 118,486,193 N158D probably benign Het
Tle2 T C 10: 81,580,584 L180P probably damaging Het
Txlnb T C 10: 17,838,909 L363P probably damaging Het
Upk3b C G 5: 136,044,036 A258G probably benign Het
Usp32 A T 11: 85,017,786 D1031E possibly damaging Het
Vmn2r116 C T 17: 23,401,067 L592F probably benign Het
Zfp607b A G 7: 27,702,869 H250R probably damaging Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58037809 missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58095988 missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58012325 missense probably benign 0.00
IGL01011:Fbn2 APN 18 58095240 splice site probably benign
IGL01123:Fbn2 APN 18 58104081 missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58061745 missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58113370 missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58203833 missense probably null 0.67
IGL01608:Fbn2 APN 18 58053704 nonsense probably null
IGL01682:Fbn2 APN 18 58072671 missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58075977 splice site probably null
IGL01764:Fbn2 APN 18 58045351 missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58114553 missense probably benign 0.01
IGL02010:Fbn2 APN 18 58037722 missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58209603 missense probably benign 0.04
IGL02037:Fbn2 APN 18 58096015 missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58076705 missense probably benign
IGL03233:Fbn2 APN 18 58102377 missense probably benign 0.39
IGL03347:Fbn2 APN 18 58013665 missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58050243 missense possibly damaging 0.95
pinch UTSW 18 58069184 missense probably damaging 1.00
stick UTSW 18 58071819 missense possibly damaging 0.94
tweak UTSW 18 58058389 missense probably damaging 1.00
PIT4434001:Fbn2 UTSW 18 58096062 missense probably damaging 0.99
R0020:Fbn2 UTSW 18 58105164 missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58069184 missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58056203 missense probably benign 0.00
R0116:Fbn2 UTSW 18 58102373 nonsense probably null
R0277:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58050290 splice site probably benign
R0316:Fbn2 UTSW 18 58113325 missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58027804 splice site probably benign
R0455:Fbn2 UTSW 18 58035336 missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58039460 missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58013749 missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58037747 missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58045374 missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58058389 missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58012353 missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58070016 missense probably benign 0.00
R1319:Fbn2 UTSW 18 58200610 missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58080193 missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58053659 missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58010380 missense probably benign
R1612:Fbn2 UTSW 18 58061752 missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58048548 missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58026538 missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58058462 missense probably benign 0.41
R1722:Fbn2 UTSW 18 58048052 critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58050276 missense probably benign 0.35
R1802:Fbn2 UTSW 18 58052976 nonsense probably null
R1850:Fbn2 UTSW 18 58039305 splice site probably benign
R1913:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58090658 missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58048849 missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58102325 splice site probably null
R2207:Fbn2 UTSW 18 58081399 nonsense probably null
R2219:Fbn2 UTSW 18 58052963 missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58095176 splice site probably benign
R2375:Fbn2 UTSW 18 58035966 missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58203787 missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58093359 missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58069242 missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58093387 missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58066011 missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58053769 missense probably benign 0.01
R4133:Fbn2 UTSW 18 58095962 missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58023287 nonsense probably null
R4288:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58076074 missense probably benign 0.00
R4601:Fbn2 UTSW 18 58053733 missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58190269 nonsense probably null
R4626:Fbn2 UTSW 18 58013747 nonsense probably null
R4638:Fbn2 UTSW 18 58010304 missense probably benign 0.01
R4675:Fbn2 UTSW 18 58040193 missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58056272 missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58026386 missense probably benign 0.00
R4945:Fbn2 UTSW 18 58050253 missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58058383 missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58010631 missense probably benign 0.05
R4998:Fbn2 UTSW 18 58072631 missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58039340 missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58039315 missense probably benign 0.00
R5414:Fbn2 UTSW 18 58093405 missense probably damaging 0.96
R5557:Fbn2 UTSW 18 58115659 missense probably benign 0.00
R5754:Fbn2 UTSW 18 58124311 missense probably benign 0.04
R5769:Fbn2 UTSW 18 58105199 missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58076696 missense probably benign 0.34
R5830:Fbn2 UTSW 18 58114469 missense probably benign 0.01
R5845:Fbn2 UTSW 18 58053768 missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58023282 nonsense probably null
R5907:Fbn2 UTSW 18 58045337 missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58037049 missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58044256 missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58048920 missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58069524 missense probably benign 0.31
R6024:Fbn2 UTSW 18 58076836 missense probably benign 0.03
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6315:Fbn2 UTSW 18 58054953 critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58113363 missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58063575 missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58102390 missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58035960 missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58113333 missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58010614 missense probably benign 0.00
R6801:Fbn2 UTSW 18 58113348 missense probably benign 0.04
R6862:Fbn2 UTSW 18 58124321 missense probably benign 0.04
R6900:Fbn2 UTSW 18 58076831 missense probably benign
R6906:Fbn2 UTSW 18 58071819 missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58124187 intron probably null
R6950:Fbn2 UTSW 18 58035921 missense probably null 0.21
R6985:Fbn2 UTSW 18 58068388 missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58076726 missense probably benign
X0062:Fbn2 UTSW 18 58056213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTGCTTTCACTAGAGGTAAC -3'
(R):5'- ATATGGATCACCTCTTACCAGCC -3'

Sequencing Primer
(F):5'- GGTAACTCCTGATTTTCACCCACTG -3'
(R):5'- ACCTCTTACCAGCCATTATTTTATAC -3'
Posted On2016-10-24