Incidental Mutation 'R5548:Gm8994'
ID434988
Institutional Source Beutler Lab
Gene Symbol Gm8994
Ensembl Gene ENSMUSG00000094973
Gene Namepredicted gene 8994
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location136327539-136329983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136329570 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 343 (V343A)
Ref Sequence ENSEMBL: ENSMUSP00000144809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077886] [ENSMUST00000204530] [ENSMUST00000204966]
Predicted Effect probably damaging
Transcript: ENSMUST00000077886
AA Change: V343A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133154
Gene: ENSMUSG00000094973
AA Change: V343A

DomainStartEndE-ValueType
DEXDc 57 254 4.55e-57 SMART
HELICc 291 372 1.63e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204530
AA Change: V343A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144809
Gene: ENSMUSG00000094973
AA Change: V343A

DomainStartEndE-ValueType
DEXDc 57 254 4.55e-57 SMART
HELICc 291 372 1.63e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204966
SMART Domains Protein: ENSMUSP00000145166
Gene: ENSMUSG00000094973

DomainStartEndE-ValueType
DEXDc 57 233 1.8e-41 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Gm8994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Gm8994 APN 6 136329111 missense probably damaging 1.00
IGL02480:Gm8994 APN 6 136329215 missense probably damaging 1.00
IGL03048:Gm8994 UTSW 6 136329200 missense probably damaging 1.00
R0153:Gm8994 UTSW 6 136328844 missense probably damaging 0.99
R1602:Gm8994 UTSW 6 136328780 missense probably damaging 0.98
R2258:Gm8994 UTSW 6 136328561 missense probably benign 0.00
R3915:Gm8994 UTSW 6 136329422 missense probably benign 0.04
R4898:Gm8994 UTSW 6 136328739 missense possibly damaging 0.60
R4902:Gm8994 UTSW 6 136329264 missense probably benign 0.42
R5349:Gm8994 UTSW 6 136329696 missense probably damaging 1.00
R5488:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5491:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5493:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5494:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5668:Gm8994 UTSW 6 136329395 missense probably benign 0.00
R5998:Gm8994 UTSW 6 136328624 missense probably benign 0.23
R6393:Gm8994 UTSW 6 136328598 missense probably benign
R6898:Gm8994 UTSW 6 136328619 missense probably benign 0.10
R7180:Gm8994 UTSW 6 136329537 missense probably damaging 1.00
R7193:Gm8994 UTSW 6 136329215 missense probably damaging 1.00
R7274:Gm8994 UTSW 6 136329398 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCATCTTCTGCATCACCAAGAG -3'
(R):5'- CAGCTTCAGATGAGGTCAGC -3'

Sequencing Primer
(F):5'- TCTTCTGCATCACCAAGAGGAAGG -3'
(R):5'- CTTCAGATGAGGTCAGCCAGGTTC -3'
Posted On2016-10-24