Incidental Mutation 'R5548:Dennd5b'
List |< first << previous [record 56 of 217] next >> last >|
ID434989
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene NameDENN/MADD domain containing 5B
Synonyms9330160C06Rik, D030011O10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location148988071-149101680 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) T to C at 149019349 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
Predicted Effect probably null
Transcript: ENSMUST00000111557
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150436
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 149027330 missense probably damaging 1.00
IGL00590:Dennd5b APN 6 149068308 missense probably benign 0.03
IGL00727:Dennd5b APN 6 149006716 splice site probably benign
IGL00838:Dennd5b APN 6 149005363 splice site probably benign
IGL01115:Dennd5b APN 6 149009748 splice site probably benign
IGL01150:Dennd5b APN 6 149068085 missense probably benign 0.01
IGL01873:Dennd5b APN 6 149044529 missense probably benign
IGL01991:Dennd5b APN 6 149080824 missense probably damaging 1.00
IGL02226:Dennd5b APN 6 149033301 missense probably benign 0.00
IGL02820:Dennd5b APN 6 149019342 missense probably null 0.51
IGL03056:Dennd5b APN 6 149055072 missense probably damaging 1.00
IGL03085:Dennd5b APN 6 149027395 missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148998260 missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148993759 missense probably benign 0.13
R0617:Dennd5b UTSW 6 149033262 splice site probably benign
R1241:Dennd5b UTSW 6 149068490 missense probably benign 0.06
R1252:Dennd5b UTSW 6 149044487 missense probably damaging 1.00
R1255:Dennd5b UTSW 6 149041650 missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 149068205 missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148998284 missense probably damaging 1.00
R1781:Dennd5b UTSW 6 149027398 missense probably damaging 1.00
R1861:Dennd5b UTSW 6 149068262 missense probably damaging 1.00
R1907:Dennd5b UTSW 6 149041576 missense probably benign 0.00
R2412:Dennd5b UTSW 6 149005238 missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149101217 missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 149044836 missense probably benign
R4581:Dennd5b UTSW 6 149016984 splice site silent
R4654:Dennd5b UTSW 6 149006837 missense probably damaging 1.00
R4725:Dennd5b UTSW 6 149044779 missense probably damaging 0.97
R4981:Dennd5b UTSW 6 149009772 missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 149041500 intron probably null
R5400:Dennd5b UTSW 6 149000016 missense probably damaging 1.00
R5452:Dennd5b UTSW 6 149041513 splice site probably null
R5841:Dennd5b UTSW 6 149044755 missense probably benign 0.11
R5996:Dennd5b UTSW 6 149068095 missense probably benign 0.22
R6082:Dennd5b UTSW 6 149068695 missense probably damaging 0.99
R6556:Dennd5b UTSW 6 149014251 splice site probably null
R6828:Dennd5b UTSW 6 148993746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTGGTTACTGGAATGTGGTA -3'
(R):5'- TGAGTTCAAGGCCAGCCAGA -3'

Sequencing Primer
(F):5'- TTACTGGAATGTGGTACCACC -3'
(R):5'- GTTCAAGGCCAGCCAGAGTTAC -3'
Posted On2016-10-24