Incidental Mutation 'R5549:Zkscan3'
ID435054
Institutional Source Beutler Lab
Gene Symbol Zkscan3
Ensembl Gene ENSMUSG00000021327
Gene Namezinc finger with KRAB and SCAN domains 3
SynonymsZfp306, 2810435N07Rik, Zfp307, Skz1
MMRRC Submission 043106-MU
Accession Numbers

Genbank: NM_001145778, NM_023685; MGI: 1919989

Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5549 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21387003-21402755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21394063 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 189 (V189A)
Ref Sequence ENSEMBL: ENSMUSP00000153231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070785] [ENSMUST00000116433] [ENSMUST00000116434] [ENSMUST00000117721] [ENSMUST00000223831] [ENSMUST00000224820]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070785
AA Change: V218A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068424
Gene: ENSMUSG00000021327
AA Change: V218A

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 4.07e-6 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 1.38e-3 SMART
ZnF_C2H2 369 391 9.88e-5 SMART
ZnF_C2H2 397 419 1.95e-3 SMART
ZnF_C2H2 425 447 3.95e-4 SMART
ZnF_C2H2 479 501 5.21e-4 SMART
ZnF_C2H2 507 529 1.2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116433
AA Change: V218A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112134
Gene: ENSMUSG00000021327
AA Change: V218A

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116434
AA Change: V218A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112135
Gene: ENSMUSG00000021327
AA Change: V218A

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 4.07e-6 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 1.38e-3 SMART
ZnF_C2H2 369 391 9.88e-5 SMART
ZnF_C2H2 397 419 1.95e-3 SMART
ZnF_C2H2 425 447 3.95e-4 SMART
ZnF_C2H2 479 501 5.21e-4 SMART
ZnF_C2H2 507 529 1.2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117721
AA Change: V218A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112862
Gene: ENSMUSG00000021327
AA Change: V218A

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 256 3.96e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184464
Predicted Effect possibly damaging
Transcript: ENSMUST00000223831
AA Change: V51A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000224820
AA Change: V189A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,036 E324G possibly damaging Het
Acad8 C T 9: 26,985,551 R204Q probably damaging Het
Adgrg7 T G 16: 56,750,427 T413P probably damaging Het
Ankrd11 A G 8: 122,890,378 I2224T probably benign Het
Arhgap23 A G 11: 97,466,568 D964G probably damaging Het
Atf6b A G 17: 34,651,683 D367G probably damaging Het
Axdnd1 A G 1: 156,398,534 L131P probably damaging Het
BC003331 A G 1: 150,372,158 S325P possibly damaging Het
Bmp8b T C 4: 123,124,485 V383A probably damaging Het
C5ar2 A G 7: 16,236,943 V353A probably damaging Het
Ccr5 C A 9: 124,125,371 A337E probably benign Het
Cftr G A 6: 18,227,954 V382I probably benign Het
Csmd3 G C 15: 48,185,357 S446C probably damaging Het
Cyp2d12 A G 15: 82,556,297 T96A probably benign Het
Diaph3 T G 14: 86,978,670 I465L probably benign Het
Fabp3 A G 4: 130,315,225 *134W probably null Het
Fam213a T C 14: 41,004,056 K44E possibly damaging Het
Fgf22 G T 10: 79,756,862 M130I probably damaging Het
Flnc G A 6: 29,453,691 V1792M probably damaging Het
Grik3 G A 4: 125,686,045 A528T possibly damaging Het
Hecw2 G A 1: 53,925,691 R659W possibly damaging Het
Hmbs C T 9: 44,339,477 probably null Het
Ift122 T G 6: 115,892,022 L490R probably damaging Het
Igkv4-63 T C 6: 69,378,132 H55R probably damaging Het
Itga4 A T 2: 79,256,267 N96I probably damaging Het
Kcna7 A T 7: 45,406,639 H93L probably damaging Het
Klhdc7b A G 15: 89,387,359 I815V probably benign Het
Lcmt1 G A 7: 123,428,107 E298K probably damaging Het
Ly6g6f A G 17: 35,083,357 V68A possibly damaging Het
Map3k8 C T 18: 4,340,762 C184Y probably damaging Het
Mcemp1 A G 8: 3,668,340 T183A possibly damaging Het
Mobp T G 9: 120,167,810 S2R probably damaging Het
Mprip A G 11: 59,760,818 S1783G probably benign Het
Mterf3 C A 13: 66,928,257 A129S probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nr2c1 A G 10: 94,167,696 T239A probably benign Het
Olfr541 A G 7: 140,704,799 probably null Het
Oplah G A 15: 76,298,266 A963V probably damaging Het
Parp14 C T 16: 35,841,135 S1481N probably benign Het
Rictor C T 15: 6,786,910 T1221M probably damaging Het
Rpe G A 1: 66,716,004 D182N probably damaging Het
Slc24a3 C A 2: 145,606,864 P443T probably damaging Het
Slc25a47 T C 12: 108,856,217 *311Q probably null Het
Sox2 C G 3: 34,650,993 A193G probably benign Het
Svep1 T C 4: 58,057,954 S3284G probably benign Het
Zfp369 A T 13: 65,297,380 H779L probably damaging Het
Zfp513 A T 5: 31,200,603 L144Q possibly damaging Het
Zfp526 T C 7: 25,225,684 F456S possibly damaging Het
Zfp791 C T 8: 85,110,206 G343D probably damaging Het
Zfp941 A C 7: 140,808,108 I664S possibly damaging Het
Other mutations in Zkscan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Zkscan3 APN 13 21394091 splice site probably benign
IGL02406:Zkscan3 APN 13 21388178 missense possibly damaging 0.71
IGL02725:Zkscan3 APN 13 21394893 missense possibly damaging 0.85
IGL02741:Zkscan3 APN 13 21393994 missense probably benign 0.05
3-1:Zkscan3 UTSW 13 21387881 missense probably benign 0.32
R0040:Zkscan3 UTSW 13 21394920 splice site probably null
R0040:Zkscan3 UTSW 13 21394920 splice site probably null
R0133:Zkscan3 UTSW 13 21394774 missense possibly damaging 0.73
R0660:Zkscan3 UTSW 13 21388460 missense probably damaging 1.00
R0737:Zkscan3 UTSW 13 21388596 missense probably benign
R1250:Zkscan3 UTSW 13 21388524 missense probably benign 0.32
R1671:Zkscan3 UTSW 13 21396135 missense possibly damaging 0.93
R1926:Zkscan3 UTSW 13 21396446 missense possibly damaging 0.88
R2899:Zkscan3 UTSW 13 21393973 missense probably damaging 1.00
R4119:Zkscan3 UTSW 13 21393949 missense possibly damaging 0.65
R4120:Zkscan3 UTSW 13 21393949 missense possibly damaging 0.65
R4606:Zkscan3 UTSW 13 21393783 missense probably benign 0.00
R5459:Zkscan3 UTSW 13 21394812 missense probably damaging 0.96
R5631:Zkscan3 UTSW 13 21394533 missense probably damaging 1.00
R5988:Zkscan3 UTSW 13 21396291 missense probably damaging 1.00
R6495:Zkscan3 UTSW 13 21387905 missense probably damaging 0.97
R7286:Zkscan3 UTSW 13 21394813 missense probably benign
R7363:Zkscan3 UTSW 13 21387822 missense probably damaging 0.99
R7443:Zkscan3 UTSW 13 21388438 nonsense probably null
Z1088:Zkscan3 UTSW 13 21388565 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGCCTCATGGGGAAGTAGGTTC -3'
(R):5'- CCCAGTTCCTAGTTGGGATGTG -3'

Sequencing Primer
(F):5'- CTCATGGGGAAGTAGGTTCTACTATG -3'
(R):5'- TGGAAATTGAACCCAGGTCCTCTG -3'
Posted On2016-10-24