Incidental Mutation 'R5549:Map3k8'
ID435070
Institutional Source Beutler Lab
Gene Symbol Map3k8
Ensembl Gene ENSMUSG00000024235
Gene Namemitogen-activated protein kinase kinase kinase 8
SynonymsTpl2, Tpl-2, c-COT, Cot, Cot/Tpl2
MMRRC Submission 043106-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5549 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location4331327-4353015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4340762 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 184 (C184Y)
Ref Sequence ENSEMBL: ENSMUSP00000025078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025078] [ENSMUST00000173930]
Predicted Effect probably damaging
Transcript: ENSMUST00000025078
AA Change: C184Y

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025078
Gene: ENSMUSG00000024235
AA Change: C184Y

DomainStartEndE-ValueType
Pfam:Pkinase 137 388 1.1e-47 PFAM
Pfam:Pkinase_Tyr 139 386 4.6e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105472
Predicted Effect probably benign
Transcript: ENSMUST00000173930
SMART Domains Protein: ENSMUSP00000133469
Gene: ENSMUSG00000024235

DomainStartEndE-ValueType
SCOP:d1phk__ 146 169 2e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice resist endotoxic shock. Their MHC II expression is enhanced. Macrophages' TNF-alpha response to viruses and to all TLR ligands is impaired. Macrophage and T-cell secretion of other cytokines in response to various TLR ligands or OVA is aberrant. Anti-OVA Ig classes are abnormally skewed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,036 E324G possibly damaging Het
Acad8 C T 9: 26,985,551 R204Q probably damaging Het
Adgrg7 T G 16: 56,750,427 T413P probably damaging Het
Ankrd11 A G 8: 122,890,378 I2224T probably benign Het
Arhgap23 A G 11: 97,466,568 D964G probably damaging Het
Atf6b A G 17: 34,651,683 D367G probably damaging Het
Axdnd1 A G 1: 156,398,534 L131P probably damaging Het
BC003331 A G 1: 150,372,158 S325P possibly damaging Het
Bmp8b T C 4: 123,124,485 V383A probably damaging Het
C5ar2 A G 7: 16,236,943 V353A probably damaging Het
Ccr5 C A 9: 124,125,371 A337E probably benign Het
Cftr G A 6: 18,227,954 V382I probably benign Het
Csmd3 G C 15: 48,185,357 S446C probably damaging Het
Cyp2d12 A G 15: 82,556,297 T96A probably benign Het
Diaph3 T G 14: 86,978,670 I465L probably benign Het
Fabp3 A G 4: 130,315,225 *134W probably null Het
Fam213a T C 14: 41,004,056 K44E possibly damaging Het
Fgf22 G T 10: 79,756,862 M130I probably damaging Het
Flnc G A 6: 29,453,691 V1792M probably damaging Het
Grik3 G A 4: 125,686,045 A528T possibly damaging Het
Hecw2 G A 1: 53,925,691 R659W possibly damaging Het
Hmbs C T 9: 44,339,477 probably null Het
Ift122 T G 6: 115,892,022 L490R probably damaging Het
Igkv4-63 T C 6: 69,378,132 H55R probably damaging Het
Itga4 A T 2: 79,256,267 N96I probably damaging Het
Kcna7 A T 7: 45,406,639 H93L probably damaging Het
Klhdc7b A G 15: 89,387,359 I815V probably benign Het
Lcmt1 G A 7: 123,428,107 E298K probably damaging Het
Ly6g6f A G 17: 35,083,357 V68A possibly damaging Het
Mcemp1 A G 8: 3,668,340 T183A possibly damaging Het
Mobp T G 9: 120,167,810 S2R probably damaging Het
Mprip A G 11: 59,760,818 S1783G probably benign Het
Mterf3 C A 13: 66,928,257 A129S probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nr2c1 A G 10: 94,167,696 T239A probably benign Het
Olfr541 A G 7: 140,704,799 probably null Het
Oplah G A 15: 76,298,266 A963V probably damaging Het
Parp14 C T 16: 35,841,135 S1481N probably benign Het
Rictor C T 15: 6,786,910 T1221M probably damaging Het
Rpe G A 1: 66,716,004 D182N probably damaging Het
Slc24a3 C A 2: 145,606,864 P443T probably damaging Het
Slc25a47 T C 12: 108,856,217 *311Q probably null Het
Sox2 C G 3: 34,650,993 A193G probably benign Het
Svep1 T C 4: 58,057,954 S3284G probably benign Het
Zfp369 A T 13: 65,297,380 H779L probably damaging Het
Zfp513 A T 5: 31,200,603 L144Q possibly damaging Het
Zfp526 T C 7: 25,225,684 F456S possibly damaging Het
Zfp791 C T 8: 85,110,206 G343D probably damaging Het
Zfp941 A C 7: 140,808,108 I664S possibly damaging Het
Zkscan3 A G 13: 21,394,063 V189A probably damaging Het
Other mutations in Map3k8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Map3k8 APN 18 4334660 missense probably damaging 1.00
IGL02483:Map3k8 APN 18 4349318 utr 5 prime probably benign
IGL03174:Map3k8 APN 18 4349247 missense probably damaging 1.00
Flojo UTSW 18 4339548 missense possibly damaging 0.95
gnostic_gospel UTSW 18 4333965 missense probably damaging 1.00
juicy UTSW 18 4339552 missense probably damaging 0.99
Sluggish UTSW 18 4339608 splice site probably benign
R0304:Map3k8 UTSW 18 4339552 missense probably damaging 0.99
R0569:Map3k8 UTSW 18 4349162 missense probably benign 0.00
R1748:Map3k8 UTSW 18 4334766 missense probably damaging 1.00
R1793:Map3k8 UTSW 18 4332389 nonsense probably null
R2310:Map3k8 UTSW 18 4349001 missense probably benign
R3625:Map3k8 UTSW 18 4333965 missense probably damaging 1.00
R4786:Map3k8 UTSW 18 4340647 nonsense probably null
R4921:Map3k8 UTSW 18 4349124 missense possibly damaging 0.92
R4930:Map3k8 UTSW 18 4349215 nonsense probably null
R4934:Map3k8 UTSW 18 4339548 missense possibly damaging 0.95
R4956:Map3k8 UTSW 18 4339530 missense probably benign 0.00
R5241:Map3k8 UTSW 18 4340750 missense probably damaging 0.98
R6317:Map3k8 UTSW 18 4348979 critical splice donor site probably null
R6326:Map3k8 UTSW 18 4340651 missense probably damaging 1.00
R6910:Map3k8 UTSW 18 4340801 missense probably benign 0.03
R7010:Map3k8 UTSW 18 4334060 missense probably damaging 1.00
R7247:Map3k8 UTSW 18 4334036 missense probably damaging 1.00
R7300:Map3k8 UTSW 18 4349076 missense probably damaging 0.98
R7348:Map3k8 UTSW 18 4340561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCACTTTCTTGGAGTGCAG -3'
(R):5'- TGTGGTAAACATTTCTTGACACCAC -3'

Sequencing Primer
(F):5'- GTGCAGAAAATCAAGTCCCTTG -3'
(R):5'- CGGTGCTCTGTTATACACATCAAGG -3'
Posted On2016-10-24