Mutagenetix > Incidental Mutation

Incidental Mutation 'R5550:Speg'

435073

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEG, SPEGalpha, SPEGbeta, Apeg1, BPEG, D1Bwg1450e

MMRRC Submission

043107-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5550 (G1)

Quality Score

190

Status

Not validated

Chromosome

Chromosomal Location

75351941-75408964 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75405744 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 2983 (T2983S)

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000087122
AA Change: T2983S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: T2983S

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000137868
AA Change: T2730S

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143679

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	T	C	11: 119,900,129 (GRCm39)	I1295M	probably benign	Het
Adgrb2	G	T	4: 129,908,727 (GRCm39)		probably null	Het
Adig	A	T	2: 158,349,880 (GRCm39)		probably benign	Het
Atp5po	C	A	16: 91,727,292 (GRCm39)	V15F	probably damaging	Het
Bdh2	A	G	3: 134,994,074 (GRCm39)	K52R	probably benign	Het
Bud23	A	G	5: 135,092,744 (GRCm39)	V27A	probably benign	Het
Ces2b	A	G	8: 105,565,069 (GRCm39)	D551G	probably benign	Het
Csmd3	G	C	15: 48,048,753 (GRCm39)	S446C	probably damaging	Het
Dio3	A	T	12: 110,246,560 (GRCm39)	T299S	probably benign	Het
Dnah1	T	A	14: 31,038,665 (GRCm39)	I139F	probably benign	Het
Dpy30	A	G	17: 74,622,920 (GRCm39)	Y21H	probably benign	Het
Gbp4	C	T	5: 105,269,911 (GRCm39)	V306M	probably damaging	Het
Gcat	G	A	15: 78,926,411 (GRCm39)	V94M	probably benign	Het
H2bc27	A	G	11: 58,840,146 (GRCm39)	*127W	probably null	Het
Henmt1	A	G	3: 108,861,184 (GRCm39)	Y69C	probably damaging	Het
Kank4	A	G	4: 98,659,678 (GRCm39)	F800S	probably benign	Het
Lrrc37a	T	A	11: 103,389,003 (GRCm39)	T2141S	unknown	Het
Map3k4	G	A	17: 12,462,445 (GRCm39)	R1143*	probably null	Het
Mdc1	A	G	17: 36,156,776 (GRCm39)	D61G	possibly damaging	Het
Nfkbid	T	A	7: 30,125,426 (GRCm39)	L303Q	probably damaging	Het
Or2ag15	T	C	7: 106,340,340 (GRCm39)	N267S	probably benign	Het
Or6c75	A	G	10: 129,337,652 (GRCm39)	N300D	probably damaging	Het
P2ry1	T	C	3: 60,911,232 (GRCm39)	C124R	probably damaging	Het
Sntg1	C	T	1: 8,695,008 (GRCm39)	C153Y	probably damaging	Het
Tbc1d2	G	A	4: 46,646,138 (GRCm39)	P163S	probably benign	Het
Tdpoz4	A	T	3: 93,704,806 (GRCm39)	T368S	probably benign	Het
Tnks2	T	A	19: 36,839,746 (GRCm39)	V78E	probably damaging	Het
Trip12	A	G	1: 84,738,820 (GRCm39)	C709R	probably damaging	Het
Xpo5	T	A	17: 46,545,418 (GRCm39)	V828D	possibly damaging	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75,387,034 (GRCm39)	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75,387,378 (GRCm39)	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75,386,679 (GRCm39)	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75,364,746 (GRCm39)	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75,404,841 (GRCm39)	missense	probably benign	0.00
IGL01351:Speg	APN	1	75,387,920 (GRCm39)	splice site	probably benign
IGL01473:Speg	APN	1	75,404,929 (GRCm39)	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75,368,541 (GRCm39)	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75,364,471 (GRCm39)	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75,407,581 (GRCm39)	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75,367,734 (GRCm39)	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75,400,031 (GRCm39)	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75,400,559 (GRCm39)	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75,400,559 (GRCm39)	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75,407,923 (GRCm39)	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75,364,831 (GRCm39)	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75,392,241 (GRCm39)	missense	probably benign	0.39
R0112:Speg	UTSW	1	75,361,676 (GRCm39)	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75,407,581 (GRCm39)	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75,391,780 (GRCm39)	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75,400,568 (GRCm39)	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75,407,428 (GRCm39)	splice site	probably benign
R0483:Speg	UTSW	1	75,361,676 (GRCm39)	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75,404,622 (GRCm39)	missense	probably benign
R0683:Speg	UTSW	1	75,405,762 (GRCm39)	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75,400,133 (GRCm39)	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75,392,036 (GRCm39)	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75,352,318 (GRCm39)	missense	probably benign	0.00
R0866:Speg	UTSW	1	75,393,727 (GRCm39)	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75,381,705 (GRCm39)	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75,391,782 (GRCm39)	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75,405,739 (GRCm39)	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75,403,739 (GRCm39)	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75,378,145 (GRCm39)	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75,399,516 (GRCm39)	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75,407,104 (GRCm39)	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75,405,128 (GRCm39)	splice site	probably benign
R1505:Speg	UTSW	1	75,352,186 (GRCm39)	missense	probably benign	0.02
R1506:Speg	UTSW	1	75,394,307 (GRCm39)	missense	probably benign	0.03
R1531:Speg	UTSW	1	75,377,866 (GRCm39)	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75,398,595 (GRCm39)	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75,404,691 (GRCm39)	missense	probably benign
R1630:Speg	UTSW	1	75,399,621 (GRCm39)	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75,387,193 (GRCm39)	splice site	probably benign
R1673:Speg	UTSW	1	75,387,807 (GRCm39)	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75,398,388 (GRCm39)	missense	possibly damaging	0.87
R1718:Speg	UTSW	1	75,394,507 (GRCm39)	missense	probably benign	0.00
R1719:Speg	UTSW	1	75,394,507 (GRCm39)	missense	probably benign	0.00
R1759:Speg	UTSW	1	75,377,806 (GRCm39)	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75,365,649 (GRCm39)	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75,400,550 (GRCm39)	missense	probably benign
R1936:Speg	UTSW	1	75,408,052 (GRCm39)	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75,394,371 (GRCm39)	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75,407,121 (GRCm39)	missense	probably benign	0.30
R2287:Speg	UTSW	1	75,407,109 (GRCm39)	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75,383,570 (GRCm39)	missense	probably benign	0.27
R2983:Speg	UTSW	1	75,361,574 (GRCm39)	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75,399,326 (GRCm39)	nonsense	probably null
R3112:Speg	UTSW	1	75,399,326 (GRCm39)	nonsense	probably null
R3154:Speg	UTSW	1	75,378,186 (GRCm39)	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75,403,426 (GRCm39)	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75,399,191 (GRCm39)	missense	probably benign	0.27
R4133:Speg	UTSW	1	75,404,548 (GRCm39)	missense	probably benign
R4522:Speg	UTSW	1	75,404,974 (GRCm39)	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75,368,478 (GRCm39)	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75,392,039 (GRCm39)	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75,398,379 (GRCm39)	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75,400,508 (GRCm39)	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75,404,347 (GRCm39)	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75,364,513 (GRCm39)	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75,404,742 (GRCm39)	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75,404,731 (GRCm39)	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75,408,037 (GRCm39)	missense	possibly damaging	0.50
R5562:Speg	UTSW	1	75,403,700 (GRCm39)	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75,395,773 (GRCm39)	splice site	probably null
R5985:Speg	UTSW	1	75,383,328 (GRCm39)	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75,392,247 (GRCm39)	nonsense	probably null
R6038:Speg	UTSW	1	75,395,103 (GRCm39)	critical splice donor site	probably null
R6038:Speg	UTSW	1	75,395,103 (GRCm39)	critical splice donor site	probably null
R6143:Speg	UTSW	1	75,391,031 (GRCm39)	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75,383,323 (GRCm39)	nonsense	probably null
R6347:Speg	UTSW	1	75,403,519 (GRCm39)	missense	probably benign	0.00
R6453:Speg	UTSW	1	75,394,616 (GRCm39)	missense	probably benign	0.06
R6505:Speg	UTSW	1	75,406,167 (GRCm39)	missense	possibly damaging	0.93
R6505:Speg	UTSW	1	75,383,328 (GRCm39)	missense	possibly damaging	0.94
R6531:Speg	UTSW	1	75,399,401 (GRCm39)	missense	probably benign	0.03
R6566:Speg	UTSW	1	75,365,107 (GRCm39)	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75,387,039 (GRCm39)	critical splice donor site	probably null
R6819:Speg	UTSW	1	75,368,456 (GRCm39)	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75,394,547 (GRCm39)	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75,364,552 (GRCm39)	nonsense	probably null
R6981:Speg	UTSW	1	75,407,557 (GRCm39)	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75,399,912 (GRCm39)	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75,388,091 (GRCm39)	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75,383,414 (GRCm39)	critical splice donor site	probably null
R7175:Speg	UTSW	1	75,399,134 (GRCm39)	missense	probably benign	0.01
R7178:Speg	UTSW	1	75,399,027 (GRCm39)	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75,361,479 (GRCm39)	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75,407,549 (GRCm39)	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75,378,108 (GRCm39)	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75,407,923 (GRCm39)	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75,405,886 (GRCm39)	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75,382,959 (GRCm39)	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75,377,834 (GRCm39)	missense	probably benign	0.04
R7696:Speg	UTSW	1	75,405,805 (GRCm39)	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75,352,469 (GRCm39)	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75,365,514 (GRCm39)	missense	probably benign	0.00
R7824:Speg	UTSW	1	75,360,661 (GRCm39)	splice site	probably null
R7834:Speg	UTSW	1	75,361,571 (GRCm39)	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75,403,810 (GRCm39)	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75,392,065 (GRCm39)	splice site	probably benign
R8068:Speg	UTSW	1	75,398,894 (GRCm39)	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75,391,997 (GRCm39)	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75,392,240 (GRCm39)	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75,399,639 (GRCm39)	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75,395,677 (GRCm39)	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75,398,880 (GRCm39)	missense	probably benign	0.26
R8299:Speg	UTSW	1	75,364,480 (GRCm39)	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75,387,976 (GRCm39)	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75,407,953 (GRCm39)	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75,378,908 (GRCm39)	splice site	probably null
R8781:Speg	UTSW	1	75,383,665 (GRCm39)	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75,381,793 (GRCm39)	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75,404,082 (GRCm39)	critical splice donor site	probably null
R8881:Speg	UTSW	1	75,377,795 (GRCm39)	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75,365,517 (GRCm39)	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75,399,250 (GRCm39)	missense	probably benign	0.30
R9019:Speg	UTSW	1	75,405,882 (GRCm39)	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75,365,076 (GRCm39)	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75,361,654 (GRCm39)	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75,399,378 (GRCm39)	missense	probably benign	0.01
R9117:Speg	UTSW	1	75,364,444 (GRCm39)	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75,367,637 (GRCm39)	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75,361,498 (GRCm39)	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75,398,420 (GRCm39)	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75,394,377 (GRCm39)	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75,399,152 (GRCm39)	missense	probably benign
R9475:Speg	UTSW	1	75,364,735 (GRCm39)	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75,377,768 (GRCm39)	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75,377,768 (GRCm39)	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75,392,380 (GRCm39)	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75,364,447 (GRCm39)	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75,399,426 (GRCm39)	missense	probably benign	0.08
R9553:Speg	UTSW	1	75,394,645 (GRCm39)	missense	probably benign	0.00
R9767:Speg	UTSW	1	75,403,825 (GRCm39)	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75,395,617 (GRCm39)	nonsense	probably null
R9800:Speg	UTSW	1	75,399,358 (GRCm39)	missense	probably benign	0.03
X0025:Speg	UTSW	1	75,399,101 (GRCm39)	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75,400,119 (GRCm39)	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75,383,238 (GRCm39)	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75,404,327 (GRCm39)	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75,407,099 (GRCm39)	missense	probably damaging	0.99
Z1177:Speg	UTSW	1	75,405,025 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCTTGAGCCATGTACTCTTC -3'
(R):5'- CACCATAGGCTAAACGGGTG -3'

Sequencing Primer
(F):5'- TGCTGGAATTGAACTCAGGACCTC -3'
(R):5'- ACAGAGGAGTTCCCGGTTG -3'

Posted On

2016-10-24