Incidental Mutation 'R5550:Bud23'
ID435086
Institutional Source Beutler Lab
Gene Symbol Bud23
Ensembl Gene ENSMUSG00000005378
Gene NameBUD23, rRNA methyltransferase and ribosome maturation factor
Synonyms1110003N24Rik, Wbscr22
MMRRC Submission 043107-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5550 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location135052957-135064959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135063890 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 27 (V27A)
Ref Sequence ENSEMBL: ENSMUSP00000106836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071263] [ENSMUST00000071677] [ENSMUST00000085984] [ENSMUST00000111205] [ENSMUST00000141309] [ENSMUST00000148549] [ENSMUST00000201554]
Predicted Effect probably benign
Transcript: ENSMUST00000071263
SMART Domains Protein: ENSMUSP00000094318
Gene: ENSMUSG00000061118

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
DnaJ 41 99 8.75e-19 SMART
low complexity region 123 141 N/A INTRINSIC
low complexity region 167 187 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071677
SMART Domains Protein: ENSMUSP00000071600
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_11 36 120 4.7e-13 PFAM
Pfam:WBS_methylT 182 258 9.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085984
AA Change: V27A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083146
Gene: ENSMUSG00000005378
AA Change: V27A

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 143 5.3e-11 PFAM
Pfam:WBS_methylT 204 279 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111205
AA Change: V27A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106836
Gene: ENSMUSG00000005378
AA Change: V27A

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 142 1.1e-12 PFAM
Pfam:WBS_methylT 168 245 1.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129013
Predicted Effect probably benign
Transcript: ENSMUST00000141309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144891
Predicted Effect probably benign
Transcript: ENSMUST00000148549
SMART Domains Protein: ENSMUSP00000118370
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_23 3 89 1.4e-8 PFAM
Pfam:Methyltransf_11 27 93 5.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149108
Predicted Effect probably benign
Transcript: ENSMUST00000201554
Predicted Effect unknown
Transcript: ENSMUST00000202478
AA Change: V19A
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a nuclear localization signal and an S-adenosyl-L-methionine binding motif typical of methyltransferases, suggesting that the encoded protein may act on DNA methylation. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been found. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 120,009,303 I1295M probably benign Het
Adgrb2 G T 4: 130,014,934 probably null Het
Adig A T 2: 158,507,960 probably benign Het
Atp5o C A 16: 91,930,404 V15F probably damaging Het
Bdh2 A G 3: 135,288,313 K52R probably benign Het
Ces2b A G 8: 104,838,437 D551G probably benign Het
Csmd3 G C 15: 48,185,357 S446C probably damaging Het
Dio3 A T 12: 110,280,126 T299S probably benign Het
Dnah1 T A 14: 31,316,708 I139F probably benign Het
Dpy30 A G 17: 74,315,925 Y21H probably benign Het
Gbp4 C T 5: 105,122,045 V306M probably damaging Het
Gcat G A 15: 79,042,211 V94M probably benign Het
Henmt1 A G 3: 108,953,868 Y69C probably damaging Het
Hist3h2ba A G 11: 58,949,320 *127W probably null Het
Kank4 A G 4: 98,771,441 F800S probably benign Het
Lrrc37a T A 11: 103,498,177 T2141S unknown Het
Map3k4 G A 17: 12,243,558 R1143* probably null Het
Mdc1 A G 17: 35,845,884 D61G possibly damaging Het
Nfkbid T A 7: 30,426,001 L303Q probably damaging Het
Olfr697 T C 7: 106,741,133 N267S probably benign Het
Olfr790 A G 10: 129,501,783 N300D probably damaging Het
P2ry1 T C 3: 61,003,811 C124R probably damaging Het
Sntg1 C T 1: 8,624,784 C153Y probably damaging Het
Speg A T 1: 75,429,100 T2983S probably damaging Het
Tbc1d2 G A 4: 46,646,138 P163S probably benign Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnks2 T A 19: 36,862,346 V78E probably damaging Het
Trip12 A G 1: 84,761,099 C709R probably damaging Het
Xpo5 T A 17: 46,234,492 V828D possibly damaging Het
Other mutations in Bud23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Bud23 APN 5 135061081 missense probably damaging 0.99
IGL03281:Bud23 APN 5 135063887 missense probably benign 0.01
R1103:Bud23 UTSW 5 135061139 missense probably damaging 1.00
R1765:Bud23 UTSW 5 135056043 missense probably benign 0.00
R3710:Bud23 UTSW 5 135056350 missense possibly damaging 0.54
R4486:Bud23 UTSW 5 135063925 unclassified probably null
R5109:Bud23 UTSW 5 135061023 intron probably benign
R5614:Bud23 UTSW 5 135059112 missense probably benign 0.00
R5822:Bud23 UTSW 5 135063921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGCTCAATGGCTTCAAGTTC -3'
(R):5'- AGCGTTGCCATACCATCGAG -3'

Sequencing Primer
(F):5'- AAGTTCCCTTTACCGGTGGCAG -3'
(R):5'- AGATGGCATCTCGTAGCCG -3'
Posted On2016-10-24