Incidental Mutation 'R5551:Olfr1280'
ID435112
Institutional Source Beutler Lab
Gene Symbol Olfr1280
Ensembl Gene ENSMUSG00000109449
Gene Nameolfactory receptor 1280
SynonymsMOR248-1, GA_x6K02T2Q125-72366920-72367837
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111314017-111326003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111315571 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 31 (F31L)
Ref Sequence ENSEMBL: ENSMUSP00000151980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082167] [ENSMUST00000090328] [ENSMUST00000204064] [ENSMUST00000213551] [ENSMUST00000219291]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082167
AA Change: F31L

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080805
Gene: ENSMUSG00000109449
AA Change: F31L

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 3.8e-50 PFAM
Pfam:7tm_1 41 287 9.9e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090328
AA Change: F31L

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000087800
Gene: ENSMUSG00000109322
AA Change: F31L

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 3.6e-49 PFAM
Pfam:7tm_1 41 287 3.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204064
AA Change: F31L
SMART Domains Protein: ENSMUSP00000145495
Gene: ENSMUSG00000109322
AA Change: F31L

DomainStartEndE-ValueType
Pfam:7tm_4 30 298 2.1e-39 PFAM
Pfam:7tm_1 40 286 7.8e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213551
AA Change: F31L

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219291
AA Change: F31L

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Olfr1280
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Olfr1280 APN 2 111315670 missense probably damaging 1.00
IGL01906:Olfr1280 APN 2 111315901 missense probably damaging 1.00
R0078:Olfr1280 UTSW 2 111315904 missense probably benign 0.04
R0091:Olfr1280 UTSW 2 111316173 missense probably benign 0.00
R0295:Olfr1280 UTSW 2 111316154 missense probably damaging 0.99
R1650:Olfr1280 UTSW 2 111316295 missense probably benign 0.04
R1808:Olfr1280 UTSW 2 111315998 missense probably benign 0.00
R2120:Olfr1280 UTSW 2 111315499 missense probably benign 0.02
R3084:Olfr1280 UTSW 2 111316116 missense probably benign 0.36
R3085:Olfr1280 UTSW 2 111316116 missense probably benign 0.36
R3086:Olfr1280 UTSW 2 111316116 missense probably benign 0.36
R3148:Olfr1280 UTSW 2 111316288 missense possibly damaging 0.93
R4229:Olfr1280 UTSW 2 111316336 missense probably damaging 1.00
R4258:Olfr1280 UTSW 2 111315638 missense probably benign
R4908:Olfr1280 UTSW 2 111316229 missense probably benign 0.09
R4972:Olfr1280 UTSW 2 111315818 missense probably damaging 1.00
R5051:Olfr1280 UTSW 2 111316254 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGTCTGTTAGATGCGCAG -3'
(R):5'- AGAGGATCTGGCTCATGCAG -3'

Sequencing Primer
(F):5'- CTGCTGAGTTAACTATGATCATGAAG -3'
(R):5'- CCCCCAAAGGAAATGGTTTTG -3'
Posted On2016-10-24