Incidental Mutation 'R5551:Zfp282'
ID435119
Institutional Source Beutler Lab
Gene Symbol Zfp282
Ensembl Gene ENSMUSG00000025821
Gene Namezinc finger protein 282
SynonymsHUB1
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location47877204-47908485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 47890645 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 252 (A252S)
Ref Sequence ENSEMBL: ENSMUSP00000053643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061890]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061890
AA Change: A252S

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053643
Gene: ENSMUSG00000025821
AA Change: A252S

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Pfam:DUF3669 98 168 1.8e-12 PFAM
KRAB 198 260 1.04e-21 SMART
internal_repeat_1 317 372 1.1e-13 PROSPERO
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 457 499 N/A INTRINSIC
ZnF_C2H2 514 536 8.94e-3 SMART
ZnF_C2H2 542 564 4.72e-2 SMART
ZnF_C2H2 570 592 1.04e-3 SMART
ZnF_C2H2 598 620 4.24e-4 SMART
ZnF_C2H2 626 648 1.06e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125957
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Zfp282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Zfp282 APN 6 47880390 missense probably damaging 1.00
IGL00755:Zfp282 APN 6 47880390 missense probably damaging 1.00
IGL01402:Zfp282 APN 6 47897836 missense probably damaging 0.99
IGL01404:Zfp282 APN 6 47897836 missense probably damaging 0.99
IGL01484:Zfp282 APN 6 47890120 missense possibly damaging 0.76
IGL01560:Zfp282 APN 6 47880277 missense probably damaging 1.00
IGL02949:Zfp282 APN 6 47897914 missense probably damaging 1.00
FR4304:Zfp282 UTSW 6 47904797 small insertion probably benign
FR4589:Zfp282 UTSW 6 47904791 small insertion probably benign
FR4737:Zfp282 UTSW 6 47904790 small insertion probably benign
FR4737:Zfp282 UTSW 6 47904799 small insertion probably benign
FR4976:Zfp282 UTSW 6 47904790 small insertion probably benign
R0020:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R0020:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R0118:Zfp282 UTSW 6 47892932 missense probably benign 0.34
R0415:Zfp282 UTSW 6 47897881 missense probably damaging 0.99
R0415:Zfp282 UTSW 6 47905053 missense possibly damaging 0.88
R0607:Zfp282 UTSW 6 47880369 missense probably damaging 1.00
R0710:Zfp282 UTSW 6 47880384 missense probably damaging 1.00
R0946:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R1054:Zfp282 UTSW 6 47904599 missense probably benign 0.00
R1401:Zfp282 UTSW 6 47890174 nonsense probably null
R1572:Zfp282 UTSW 6 47892867 missense probably damaging 1.00
R2016:Zfp282 UTSW 6 47897787 intron probably null
R2971:Zfp282 UTSW 6 47897932 splice site probably null
R4064:Zfp282 UTSW 6 47880094 missense probably damaging 0.99
R4478:Zfp282 UTSW 6 47890696 nonsense probably null
R4530:Zfp282 UTSW 6 47890633 missense probably benign 0.00
R4532:Zfp282 UTSW 6 47890633 missense probably benign 0.00
R5068:Zfp282 UTSW 6 47877703 missense probably benign 0.01
R5261:Zfp282 UTSW 6 47897890 missense probably damaging 0.99
R5326:Zfp282 UTSW 6 47905327 missense probably benign
R6046:Zfp282 UTSW 6 47880168 missense probably damaging 1.00
R6408:Zfp282 UTSW 6 47880385 missense probably damaging 1.00
S24628:Zfp282 UTSW 6 47897881 missense probably damaging 0.99
S24628:Zfp282 UTSW 6 47905053 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGGCCTGCTTTCAAGATTCC -3'
(R):5'- ACAGCTGTGGTATAAGTGGTTCC -3'

Sequencing Primer
(F):5'- CAAGATTCCTTCTGCACATAATGGC -3'
(R):5'- TTCCTGGGTGCATTAAGACC -3'
Posted On2016-10-24