Incidental Mutation 'R5551:Zfp473'
ID435122
Institutional Source Beutler Lab
Gene Symbol Zfp473
Ensembl Gene ENSMUSG00000048012
Gene Namezinc finger protein 473
SynonymsD030014N22Rik
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44731480-44751050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 44734151 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 253 (P253A)
Ref Sequence ENSEMBL: ENSMUSP00000113774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060270] [ENSMUST00000118162] [ENSMUST00000120074] [ENSMUST00000120798] [ENSMUST00000126366] [ENSMUST00000140599] [ENSMUST00000149011]
Predicted Effect probably benign
Transcript: ENSMUST00000060270
AA Change: P253A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000051069
Gene: ENSMUSG00000048012
AA Change: P253A

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
ZnF_C2H2 209 231 1.18e-2 SMART
ZnF_C2H2 265 287 8.47e-4 SMART
ZnF_C2H2 377 399 2.4e-3 SMART
ZnF_C2H2 404 426 8.31e0 SMART
ZnF_C2H2 432 454 1.64e-1 SMART
ZnF_C2H2 460 482 1.98e-4 SMART
ZnF_C2H2 488 510 3.44e-4 SMART
ZnF_C2H2 516 538 2.57e-3 SMART
ZnF_C2H2 544 566 3.29e-1 SMART
ZnF_C2H2 572 594 2.29e0 SMART
ZnF_C2H2 697 719 1.47e1 SMART
ZnF_C2H2 725 747 1.04e-3 SMART
ZnF_C2H2 753 775 3.39e-3 SMART
ZnF_C2H2 781 803 2.24e-3 SMART
ZnF_C2H2 809 831 5.99e-4 SMART
ZnF_C2H2 837 859 1.36e-2 SMART
ZnF_C2H2 865 887 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118162
AA Change: P252A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113316
Gene: ENSMUSG00000048012
AA Change: P252A

DomainStartEndE-ValueType
KRAB 23 83 7.75e-3 SMART
ZnF_C2H2 208 230 1.18e-2 SMART
ZnF_C2H2 264 286 8.47e-4 SMART
ZnF_C2H2 376 398 2.4e-3 SMART
ZnF_C2H2 403 425 8.31e0 SMART
ZnF_C2H2 431 453 1.64e-1 SMART
ZnF_C2H2 459 481 1.98e-4 SMART
ZnF_C2H2 487 509 3.44e-4 SMART
ZnF_C2H2 515 537 2.57e-3 SMART
ZnF_C2H2 543 565 3.29e-1 SMART
ZnF_C2H2 571 593 2.29e0 SMART
ZnF_C2H2 696 718 1.47e1 SMART
ZnF_C2H2 724 746 1.04e-3 SMART
ZnF_C2H2 752 774 3.39e-3 SMART
ZnF_C2H2 780 802 2.24e-3 SMART
ZnF_C2H2 808 830 5.99e-4 SMART
ZnF_C2H2 836 858 1.36e-2 SMART
ZnF_C2H2 864 886 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120074
AA Change: P253A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113774
Gene: ENSMUSG00000048012
AA Change: P253A

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
ZnF_C2H2 209 231 1.18e-2 SMART
ZnF_C2H2 265 287 8.47e-4 SMART
ZnF_C2H2 377 399 2.4e-3 SMART
ZnF_C2H2 404 426 8.31e0 SMART
ZnF_C2H2 432 454 1.64e-1 SMART
ZnF_C2H2 460 482 1.98e-4 SMART
ZnF_C2H2 488 510 3.44e-4 SMART
ZnF_C2H2 516 538 2.57e-3 SMART
ZnF_C2H2 544 566 3.29e-1 SMART
ZnF_C2H2 572 594 2.29e0 SMART
ZnF_C2H2 697 719 1.47e1 SMART
ZnF_C2H2 725 747 1.04e-3 SMART
ZnF_C2H2 753 775 3.39e-3 SMART
ZnF_C2H2 781 803 2.24e-3 SMART
ZnF_C2H2 809 831 5.99e-4 SMART
ZnF_C2H2 837 859 1.36e-2 SMART
ZnF_C2H2 865 887 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120798
AA Change: P252A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113789
Gene: ENSMUSG00000048012
AA Change: P252A

DomainStartEndE-ValueType
KRAB 23 83 7.75e-3 SMART
ZnF_C2H2 208 230 1.18e-2 SMART
ZnF_C2H2 264 286 8.47e-4 SMART
ZnF_C2H2 376 398 2.4e-3 SMART
ZnF_C2H2 403 425 8.31e0 SMART
ZnF_C2H2 431 453 1.64e-1 SMART
ZnF_C2H2 459 481 1.98e-4 SMART
ZnF_C2H2 487 509 3.44e-4 SMART
ZnF_C2H2 515 537 2.57e-3 SMART
ZnF_C2H2 543 565 3.29e-1 SMART
ZnF_C2H2 571 593 2.29e0 SMART
ZnF_C2H2 696 718 1.47e1 SMART
ZnF_C2H2 724 746 1.04e-3 SMART
ZnF_C2H2 752 774 3.39e-3 SMART
ZnF_C2H2 780 802 2.24e-3 SMART
ZnF_C2H2 808 830 5.99e-4 SMART
ZnF_C2H2 836 858 1.36e-2 SMART
ZnF_C2H2 864 886 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126366
SMART Domains Protein: ENSMUSP00000127101
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140599
SMART Domains Protein: ENSMUSP00000127738
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149011
SMART Domains Protein: ENSMUSP00000130689
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Krueppel C2H2-type zinc-finger family of proteins. The encoded protein, a component of the U7 snRNP complex, plays a role in histone 3'-end pre-mRNA processing and may be required for cell cycle progression to S phase. Expression level and methylation status of this gene may be correlated with bone mineral density. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Zfp473
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Zfp473 APN 7 44734568 missense probably damaging 1.00
IGL01443:Zfp473 APN 7 44739563 missense probably damaging 0.99
IGL01459:Zfp473 APN 7 44739563 missense probably damaging 0.99
IGL01905:Zfp473 APN 7 44733727 missense probably benign 0.00
IGL02027:Zfp473 APN 7 44738038 splice site probably benign
IGL02314:Zfp473 APN 7 44733929 missense probably benign 0.00
IGL02445:Zfp473 APN 7 44733683 missense probably damaging 1.00
IGL03033:Zfp473 APN 7 44733098 missense probably benign 0.05
R0037:Zfp473 UTSW 7 44733900 missense probably damaging 0.96
R0054:Zfp473 UTSW 7 44734475 missense probably damaging 0.99
R0054:Zfp473 UTSW 7 44734475 missense probably damaging 0.99
R0190:Zfp473 UTSW 7 44733188 missense probably damaging 1.00
R1178:Zfp473 UTSW 7 44734594 missense probably benign 0.00
R1387:Zfp473 UTSW 7 44732941 missense probably benign 0.00
R2141:Zfp473 UTSW 7 44733077 missense possibly damaging 0.57
R2142:Zfp473 UTSW 7 44733077 missense possibly damaging 0.57
R4194:Zfp473 UTSW 7 44732252 missense probably benign 0.08
R4453:Zfp473 UTSW 7 44733254 missense probably damaging 0.99
R4585:Zfp473 UTSW 7 44732952 nonsense probably null
R4586:Zfp473 UTSW 7 44732952 nonsense probably null
R4945:Zfp473 UTSW 7 44734564 missense probably benign 0.00
R5072:Zfp473 UTSW 7 44732519 missense probably damaging 0.98
R5429:Zfp473 UTSW 7 44732848 missense possibly damaging 0.69
R5464:Zfp473 UTSW 7 44732638 missense probably damaging 1.00
R5618:Zfp473 UTSW 7 44741732 missense probably benign 0.08
R5985:Zfp473 UTSW 7 44733328 missense probably damaging 1.00
R6288:Zfp473 UTSW 7 44733534 missense probably damaging 1.00
R6701:Zfp473 UTSW 7 44732794 missense possibly damaging 0.58
R7069:Zfp473 UTSW 7 44732374 missense probably damaging 1.00
R7284:Zfp473 UTSW 7 44733203 missense not run
R7361:Zfp473 UTSW 7 44733139 missense probably damaging 1.00
R7495:Zfp473 UTSW 7 44737944 missense probably benign 0.04
X0027:Zfp473 UTSW 7 44733418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGTCTTTACTCAGCCGC -3'
(R):5'- CTGAAGGAATCCAGGAGTGACC -3'

Sequencing Primer
(F):5'- TTCCTGGCTCGACACTCGG -3'
(R):5'- CTGAGCCAGGAGGACTCTGTC -3'
Posted On2016-10-24