Incidental Mutation 'R5551:Smad5'
ID435143
Institutional Source Beutler Lab
Gene Symbol Smad5
Ensembl Gene ENSMUSG00000021540
Gene NameSMAD family member 5
SynonymsSmad 5, Madh5, MusMLP
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location56703010-56742377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56735841 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 347 (C347R)
Ref Sequence ENSEMBL: ENSMUSP00000105502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069557] [ENSMUST00000109874] [ENSMUST00000109876]
Predicted Effect probably damaging
Transcript: ENSMUST00000069557
AA Change: C347R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065798
Gene: ENSMUSG00000021540
AA Change: C347R

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109874
AA Change: C347R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105500
Gene: ENSMUSG00000021540
AA Change: C347R

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109876
AA Change: C347R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105502
Gene: ENSMUSG00000021540
AA Change: C347R

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138677
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the transforming growth factor beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. The encoded protein is activated by bone morphogenetic proteins type 1 receptor kinase, and may be involved in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit vascular, craniofacial, and neural tube defects, improper turning, edema, and a deficiency of primordial germ cells. Mutants die between embryonic days 10.5 and 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Smad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Smad5 APN 13 56723667 missense probably benign 0.11
IGL01407:Smad5 APN 13 56735817 missense probably benign 0.00
IGL02267:Smad5 APN 13 56735790 splice site probably benign
IGL03014:Smad5 UTSW 13 56735941 missense probably damaging 1.00
R1317:Smad5 UTSW 13 56736071 splice site probably benign
R2001:Smad5 UTSW 13 56737374 missense probably damaging 0.99
R5401:Smad5 UTSW 13 56727469 missense probably benign 0.00
R5734:Smad5 UTSW 13 56723804 missense probably damaging 1.00
R5796:Smad5 UTSW 13 56723832 missense probably damaging 0.98
R5988:Smad5 UTSW 13 56735985 missense probably damaging 0.99
R7557:Smad5 UTSW 13 56727469 missense probably benign 0.00
Z1088:Smad5 UTSW 13 56728628 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGCAGTTTACAAACCTGC -3'
(R):5'- CAGCCTCGAATCCATGGTTG -3'

Sequencing Primer
(F):5'- AGATAATTTCTGGCTGCTGAAGG -3'
(R):5'- AATCCATGGTTGACTGACTGAGCC -3'
Posted On2016-10-24