Incidental Mutation 'R5551:Tars'
ID435147
Institutional Source Beutler Lab
Gene Symbol Tars
Ensembl Gene ENSMUSG00000022241
Gene Namethreonyl-tRNA synthetase
SynonymsD15Wsu59e, ThrRS
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location11382301-11399665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11391982 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 248 (T248M)
Ref Sequence ENSEMBL: ENSMUSP00000022849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022849] [ENSMUST00000228814]
Predicted Effect probably damaging
Transcript: ENSMUST00000022849
AA Change: T248M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022849
Gene: ENSMUSG00000022241
AA Change: T248M

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Pfam:TGS 82 142 7.5e-18 PFAM
tRNA_SAD 248 297 1.91e-16 SMART
Pfam:tRNA-synt_2b 396 607 5e-38 PFAM
Pfam:HGTP_anticodon 619 710 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228710
Predicted Effect probably benign
Transcript: ENSMUST00000228814
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Threonyl-tRNA synthetase belongs to the class-II aminoacyl-tRNA synthetase family [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Tars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Tars APN 15 11388221 splice site probably null
IGL00642:Tars APN 15 11394372 missense probably damaging 1.00
IGL01315:Tars APN 15 11389734 nonsense probably null
IGL01459:Tars APN 15 11391854 missense possibly damaging 0.76
IGL02141:Tars APN 15 11391194 missense probably damaging 0.96
IGL03292:Tars APN 15 11384021 missense probably benign 0.22
R0383:Tars UTSW 15 11390325 missense probably benign
R0517:Tars UTSW 15 11394366 nonsense probably null
R0685:Tars UTSW 15 11385173 missense probably benign
R1589:Tars UTSW 15 11388175 missense probably benign 0.32
R1753:Tars UTSW 15 11394243 nonsense probably null
R2051:Tars UTSW 15 11393194 nonsense probably null
R2060:Tars UTSW 15 11394373 missense probably benign 0.03
R2216:Tars UTSW 15 11389708 missense probably benign 0.00
R3610:Tars UTSW 15 11392904 missense probably damaging 0.99
R4656:Tars UTSW 15 11394264 missense probably damaging 1.00
R4844:Tars UTSW 15 11385195 missense possibly damaging 0.85
R4974:Tars UTSW 15 11390391 missense probably damaging 1.00
R5992:Tars UTSW 15 11397196 missense probably damaging 1.00
R6742:Tars UTSW 15 11394341 missense probably damaging 0.98
R6778:Tars UTSW 15 11389699 missense probably benign 0.06
R6850:Tars UTSW 15 11392799 missense probably benign
R7270:Tars UTSW 15 11392019 missense probably benign 0.00
R7401:Tars UTSW 15 11392009 nonsense probably null
Z1088:Tars UTSW 15 11391884 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GCCTCACCTTGTGTATCTTCAAAG -3'
(R):5'- TGATGTTATTAGCCAGCCCTTC -3'

Sequencing Primer
(F):5'- CAAAGTCTTAATCTTGCCGGTG -3'
(R):5'- CCCTTCAAGTCGTGTGTCAGAG -3'
Posted On2016-10-24