Incidental Mutation 'R5551:Adamts1'
ID435153
Institutional Source Beutler Lab
Gene Symbol Adamts1
Ensembl Gene ENSMUSG00000022893
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1
SynonymsMETH1, ADAMTS-1, ADAM-TS1, METH-1
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location85793827-85803113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85797746 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 405 (I405T)
Ref Sequence ENSEMBL: ENSMUSP00000118471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023610] [ENSMUST00000125897]
Predicted Effect probably benign
Transcript: ENSMUST00000023610
AA Change: I668T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023610
Gene: ENSMUSG00000022893
AA Change: I668T

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 22 194 1.3e-27 PFAM
Pfam:Reprolysin_4 257 464 2.2e-9 PFAM
Pfam:Reprolysin_5 257 466 1.6e-14 PFAM
Pfam:Reprolysin 259 468 3.6e-22 PFAM
Pfam:Reprolysin_2 279 458 2.1e-10 PFAM
Pfam:Reprolysin_3 281 413 4.8e-14 PFAM
ACR 469 549 7.36e-8 SMART
TSP1 563 615 3.77e-14 SMART
Pfam:ADAM_spacer1 726 844 1.7e-35 PFAM
TSP1 858 911 1.22e-8 SMART
TSP1 912 968 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125897
AA Change: I405T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118471
Gene: ENSMUSG00000022893
AA Change: I405T

DomainStartEndE-ValueType
Pfam:Reprolysin_4 1 201 2.3e-9 PFAM
Pfam:Reprolysin_5 1 203 8.8e-14 PFAM
Pfam:Reprolysin 1 205 5e-22 PFAM
Pfam:Reprolysin_2 16 195 8.6e-10 PFAM
Pfam:Reprolysin_3 19 150 4.2e-14 PFAM
ACR 206 286 7.36e-8 SMART
TSP1 300 352 3.77e-14 SMART
Pfam:ADAM_spacer1 463 581 3e-35 PFAM
TSP1 595 648 1.22e-8 SMART
TSP1 649 680 4.85e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138474
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family and preproprotein that is proteolytically processed to generate a mature protein product. This secreted protein product plays an important role in ovulation, likely through its cleavage of the extracellular matrix component versican. The encoded protein may enhance tumorigenesis in a mouse model of breast cancer. Homozygous knockout mice for this gene exhibit enhanced perinatal lethality, impaired growth and adipose tissue development, and impaired ovulation in females. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display growth retardation with adipose tissue malformation, impaired female fertility, enlarged renal calices and abnormal adrenal medullary architecture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Adamts1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Adamts1 APN 16 85795573 missense probably benign
IGL01753:Adamts1 APN 16 85802224 missense probably benign 0.00
IGL02238:Adamts1 APN 16 85795825 missense probably benign 0.01
IGL02655:Adamts1 APN 16 85802617 missense probably benign
PIT4466001:Adamts1 UTSW 16 85796691 nonsense probably null
R0114:Adamts1 UTSW 16 85799614 missense probably benign 0.10
R0135:Adamts1 UTSW 16 85798703 splice site probably benign
R0179:Adamts1 UTSW 16 85795465 missense probably benign 0.00
R0517:Adamts1 UTSW 16 85800353 missense possibly damaging 0.96
R0526:Adamts1 UTSW 16 85802372 missense probably benign
R0727:Adamts1 UTSW 16 85798648 missense possibly damaging 0.51
R0899:Adamts1 UTSW 16 85798052 nonsense probably null
R1163:Adamts1 UTSW 16 85802637 missense probably benign 0.07
R1555:Adamts1 UTSW 16 85797888 missense probably benign 0.17
R1598:Adamts1 UTSW 16 85798511 nonsense probably null
R1643:Adamts1 UTSW 16 85796817 splice site probably benign
R1847:Adamts1 UTSW 16 85802226 missense possibly damaging 0.89
R2045:Adamts1 UTSW 16 85795976 missense probably damaging 1.00
R2093:Adamts1 UTSW 16 85802445 missense probably benign 0.23
R2966:Adamts1 UTSW 16 85796774 missense possibly damaging 0.94
R3937:Adamts1 UTSW 16 85795619 missense possibly damaging 0.90
R3938:Adamts1 UTSW 16 85795619 missense possibly damaging 0.90
R4348:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4350:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4351:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4352:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4470:Adamts1 UTSW 16 85798516 missense possibly damaging 0.88
R4724:Adamts1 UTSW 16 85802505 missense probably benign 0.00
R4775:Adamts1 UTSW 16 85800390 nonsense probably null
R4972:Adamts1 UTSW 16 85795945 missense probably damaging 1.00
R5353:Adamts1 UTSW 16 85802608 missense probably benign 0.00
R5420:Adamts1 UTSW 16 85799609 nonsense probably null
R5574:Adamts1 UTSW 16 85799642 missense probably damaging 1.00
R5759:Adamts1 UTSW 16 85798048 missense possibly damaging 0.93
R5860:Adamts1 UTSW 16 85798544 missense probably damaging 1.00
R5910:Adamts1 UTSW 16 85802149 missense probably benign 0.00
R6240:Adamts1 UTSW 16 85802157 missense probably benign
R6473:Adamts1 UTSW 16 85799643 missense probably damaging 1.00
R6623:Adamts1 UTSW 16 85795637 missense probably benign 0.20
R6628:Adamts1 UTSW 16 85795825 missense probably benign 0.05
R7034:Adamts1 UTSW 16 85802746 unclassified probably benign
R7174:Adamts1 UTSW 16 85799172 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTAAGCTTCCTTCCCAACAGAAG -3'
(R):5'- AAACTGGGAACATCATCGCC -3'

Sequencing Primer
(F):5'- TCCCAAAGCAAGGAGTTGTTC -3'
(R):5'- CGTCGTTCTCTTTTCAGGAAAAACG -3'
Posted On2016-10-24