Incidental Mutation 'R5551:Tcirg1'
ID435159
Institutional Source Beutler Lab
Gene Symbol Tcirg1
Ensembl Gene ENSMUSG00000001750
Gene NameT cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3
SynonymsAtp6i, V-ATPase a3, ATP6a3, TIRC7, OC-116
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3896050-3907133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3898858 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 442 (F442L)
Ref Sequence ENSEMBL: ENSMUSP00000122474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001801] [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000122885] [ENSMUST00000126070] [ENSMUST00000128694] [ENSMUST00000135070] [ENSMUST00000145791]
Predicted Effect probably damaging
Transcript: ENSMUST00000001801
AA Change: F442L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001801
Gene: ENSMUSG00000001750
AA Change: F442L

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025760
SMART Domains Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 373 2.4e-11 PFAM
Pfam:Choline_kinase 135 370 8.2e-82 PFAM
Pfam:EcKinase 211 345 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072055
SMART Domains Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 358 6.4e-12 PFAM
Pfam:Choline_kinase 135 352 1.6e-84 PFAM
Pfam:EcKinase 190 329 2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122885
SMART Domains Protein: ENSMUSP00000114768
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 91 2.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125859
Predicted Effect probably damaging
Transcript: ENSMUST00000126070
AA Change: F442L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120531
Gene: ENSMUSG00000001750
AA Change: F442L

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 1.2e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127308
Predicted Effect probably benign
Transcript: ENSMUST00000128694
SMART Domains Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
PDB:4DA5|B 1 150 2e-60 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131327
Predicted Effect probably benign
Transcript: ENSMUST00000132164
SMART Domains Protein: ENSMUSP00000120968
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 190 4.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134698
Predicted Effect probably benign
Transcript: ENSMUST00000135070
SMART Domains Protein: ENSMUSP00000121241
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145791
AA Change: F442L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122474
Gene: ENSMUSG00000001750
AA Change: F442L

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162688
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Through alternate splicing, this gene encodes two proteins with similarity to subunits of the vacuolar ATPase (V-ATPase) but the encoded proteins seem to have different functions. V-ATPase is a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Mutations in this gene are associated with infantile malignant osteopetrosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for mutant alleles exhibit severe osteopetrosis with increased bone density due to failure of secondary bone resorption. Mutants lack teeth and die around 30-40 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Tcirg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Tcirg1 APN 19 3899108 missense possibly damaging 0.94
IGL01735:Tcirg1 APN 19 3904210 splice site probably benign
IGL03143:Tcirg1 APN 19 3898811 missense probably damaging 1.00
R0732:Tcirg1 UTSW 19 3897866 missense possibly damaging 0.56
R1131:Tcirg1 UTSW 19 3896301 missense probably damaging 1.00
R1223:Tcirg1 UTSW 19 3898733 missense probably benign 0.01
R1548:Tcirg1 UTSW 19 3896845 missense probably benign 0.03
R1867:Tcirg1 UTSW 19 3898835 missense probably damaging 1.00
R1926:Tcirg1 UTSW 19 3902843 intron probably benign
R2262:Tcirg1 UTSW 19 3903591 missense possibly damaging 0.89
R4367:Tcirg1 UTSW 19 3899069 missense probably damaging 1.00
R5327:Tcirg1 UTSW 19 3902342 critical splice donor site probably null
R5417:Tcirg1 UTSW 19 3903509 splice site probably null
R5930:Tcirg1 UTSW 19 3902424 missense possibly damaging 0.95
R6026:Tcirg1 UTSW 19 3897487 missense probably benign
R6517:Tcirg1 UTSW 19 3901933 missense probably damaging 1.00
R7039:Tcirg1 UTSW 19 3896666 missense probably damaging 1.00
R7181:Tcirg1 UTSW 19 3903576 missense probably null 0.56
Predicted Primers PCR Primer
(F):5'- GGGACAGATACTCGTCACTG -3'
(R):5'- GTCCTCACTGAAAACCGTCC -3'

Sequencing Primer
(F):5'- TGTCAGAGCTGCACAGTG -3'
(R):5'- TGAAAACCGTCCAGCTGTG -3'
Posted On2016-10-24