Incidental Mutation 'R5553:Ankrd39'
ID435201
Institutional Source Beutler Lab
Gene Symbol Ankrd39
Ensembl Gene ENSMUSG00000079610
Gene Nameankyrin repeat domain 39
SynonymsC030004B10Rik, 9130416N05Rik
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location36537507-36547445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36541981 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 96 (G96R)
Ref Sequence ENSEMBL: ENSMUSP00000141712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001172] [ENSMUST00000191849] [ENSMUST00000194894] [ENSMUST00000207088] [ENSMUST00000207843]
Predicted Effect probably damaging
Transcript: ENSMUST00000001172
AA Change: G96R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001172
Gene: ENSMUSG00000079610
AA Change: G96R

DomainStartEndE-ValueType
ANK 30 59 8.77e2 SMART
ANK 63 92 1.08e-5 SMART
ANK 96 127 1.27e-2 SMART
ANK 129 158 5.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191849
SMART Domains Protein: ENSMUSP00000142202
Gene: ENSMUSG00000109510

DomainStartEndE-ValueType
Blast:ANK 1 26 9e-9 BLAST
ANK 30 59 1.12e-3 SMART
ANK 63 92 1.4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192954
AA Change: G166R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194787
AA Change: G84R
Predicted Effect probably damaging
Transcript: ENSMUST00000194894
AA Change: G96R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141712
Gene: ENSMUSG00000079610
AA Change: G96R

DomainStartEndE-ValueType
ANK 30 59 5.6e0 SMART
ANK 63 92 7.1e-8 SMART
ANK 96 127 8.2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207088
Predicted Effect probably benign
Transcript: ENSMUST00000207843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208690
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Ankrd39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Ankrd39 APN 1 36542061 missense probably damaging 0.98
R1637:Ankrd39 UTSW 1 36539492 nonsense probably null
R4249:Ankrd39 UTSW 1 36547155 missense probably benign 0.00
R5548:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
R5551:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
R5552:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
R5554:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
R5591:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
R5594:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTAAAGGAGACTGCGAC -3'
(R):5'- AACTTTGGTCCCATCCTGAGC -3'

Sequencing Primer
(F):5'- GGAGACTGCGACATACCTTATGC -3'
(R):5'- AATTAGTGGAAGGGCACAGTGTTTC -3'
Posted On2016-10-24