Incidental Mutation 'R5553:Plekhm3'
ID435202
Institutional Source Beutler Lab
Gene Symbol Plekhm3
Ensembl Gene ENSMUSG00000051344
Gene Namepleckstrin homology domain containing, family M, member 3
Synonyms9430067K14Rik, A230102O09Rik, Plekhm1l
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location64785983-64956824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64921886 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 404 (S404G)
Ref Sequence ENSEMBL: ENSMUSP00000138002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097713] [ENSMUST00000139649]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097713
AA Change: S404G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095320
Gene: ENSMUSG00000051344
AA Change: S404G

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139649
AA Change: S404G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138002
Gene: ENSMUSG00000051344
AA Change: S404G

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140857
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Plekhm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Plekhm3 APN 1 64921832 missense probably damaging 1.00
IGL01732:Plekhm3 APN 1 64922248 missense probably benign 0.44
IGL02422:Plekhm3 APN 1 64921866 nonsense probably null
IGL02724:Plekhm3 APN 1 64795117 missense probably damaging 0.97
IGL03226:Plekhm3 APN 1 64921800 missense possibly damaging 0.58
IGL03250:Plekhm3 APN 1 64938047 missense possibly damaging 0.65
R0124:Plekhm3 UTSW 1 64921751 missense probably damaging 0.99
R1336:Plekhm3 UTSW 1 64937781 small deletion probably benign
R1467:Plekhm3 UTSW 1 64892882 missense probably damaging 1.00
R1467:Plekhm3 UTSW 1 64892882 missense probably damaging 1.00
R1560:Plekhm3 UTSW 1 64937817 missense probably benign 0.03
R1901:Plekhm3 UTSW 1 64937781 small deletion probably benign
R2328:Plekhm3 UTSW 1 64937781 small deletion probably benign
R2432:Plekhm3 UTSW 1 64937856 missense probably damaging 1.00
R2568:Plekhm3 UTSW 1 64937781 small deletion probably benign
R3023:Plekhm3 UTSW 1 64937781 small deletion probably benign
R4496:Plekhm3 UTSW 1 64861236 missense probably damaging 1.00
R4529:Plekhm3 UTSW 1 64937825 missense probably benign 0.14
R4682:Plekhm3 UTSW 1 64937927 missense possibly damaging 0.94
R4969:Plekhm3 UTSW 1 64937919 missense probably damaging 1.00
R5347:Plekhm3 UTSW 1 64819990 missense probably damaging 1.00
R5583:Plekhm3 UTSW 1 64937986 nonsense probably null
R5953:Plekhm3 UTSW 1 64937895 missense probably damaging 0.98
R6319:Plekhm3 UTSW 1 64921934 missense probably benign 0.20
R6970:Plekhm3 UTSW 1 64892753 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGAACTCCTTGCAGCGTTGG -3'
(R):5'- CATCCATCATGGTGACTGTGC -3'

Sequencing Primer
(F):5'- GCTGCTGTCTTCAGAGCC -3'
(R):5'- CATCATGGTGACTGTGCACAGAAC -3'
Posted On2016-10-24