Incidental Mutation 'R5553:Olfr352'
ID435206
Institutional Source Beutler Lab
Gene Symbol Olfr352
Ensembl Gene ENSMUSG00000053146
Gene Nameolfactory receptor 352
SynonymsGA_x6K02T2NLDC-33564136-33565083, MOR136-10
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36868460-36872785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36870465 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 300 (I300V)
Ref Sequence ENSEMBL: ENSMUSP00000149568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065416] [ENSMUST00000217325]
Predicted Effect probably benign
Transcript: ENSMUST00000065416
AA Change: I300V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000070758
Gene: ENSMUSG00000053146
AA Change: I300V

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.4e-56 PFAM
Pfam:7TM_GPCR_Srsx 38 308 1.8e-7 PFAM
Pfam:7tm_1 44 293 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217325
AA Change: I300V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Olfr352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Olfr352 APN 2 36870210 missense probably benign 0.01
IGL01538:Olfr352 APN 2 36870520 utr 3 prime probably benign
IGL01716:Olfr352 APN 2 36869667 missense probably benign 0.11
IGL01735:Olfr352 APN 2 36869686 missense possibly damaging 0.95
IGL01998:Olfr352 APN 2 36869646 missense probably benign 0.01
IGL02820:Olfr352 APN 2 36869859 missense probably benign 0.01
IGL03267:Olfr352 APN 2 36870501 missense probably benign 0.00
IGL03306:Olfr352 APN 2 36870525 utr 3 prime probably benign
R0013:Olfr352 UTSW 2 36870160 missense probably damaging 1.00
R0081:Olfr352 UTSW 2 36870010 missense possibly damaging 0.58
R0421:Olfr352 UTSW 2 36869641 missense possibly damaging 0.89
R1613:Olfr352 UTSW 2 36870393 missense possibly damaging 0.91
R1842:Olfr352 UTSW 2 36869589 missense probably damaging 1.00
R2698:Olfr352 UTSW 2 36870196 missense possibly damaging 0.94
R4463:Olfr352 UTSW 2 36870193 missense probably benign 0.31
R4993:Olfr352 UTSW 2 36869988 missense probably benign 0.30
R5666:Olfr352 UTSW 2 36870389 missense probably benign 0.11
R5934:Olfr352 UTSW 2 36870268 missense probably benign 0.34
R6290:Olfr352 UTSW 2 36870436 missense probably damaging 1.00
R6312:Olfr352 UTSW 2 36870465 missense probably benign 0.02
X0022:Olfr352 UTSW 2 36870277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCTTGTCCACGTGTG -3'
(R):5'- ATGAGCAAAAGCCGGTATCATATG -3'

Sequencing Primer
(F):5'- CACGTGTGGCTCTCACC -3'
(R):5'- TTCCTCCAAGACTTTAAAAACTGAC -3'
Posted On2016-10-24