Incidental Mutation 'R5553:Rc3h2'
ID435207
Institutional Source Beutler Lab
Gene Symbol Rc3h2
Ensembl Gene ENSMUSG00000075376
Gene Namering finger and CCCH-type zinc finger domains 2
SynonymsMnab, D930043C02Rik, Rnf164, 2900024N03Rik, 9430019J22Rik
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37370069-37422903 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 37398311 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 420 (R420*)
Ref Sequence ENSEMBL: ENSMUSP00000145082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100143] [ENSMUST00000112934] [ENSMUST00000112936] [ENSMUST00000125619]
Predicted Effect probably null
Transcript: ENSMUST00000100143
AA Change: R420*
SMART Domains Protein: ENSMUSP00000097721
Gene: ENSMUSG00000075376
AA Change: R420*

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104568
Predicted Effect probably null
Transcript: ENSMUST00000112934
AA Change: R420*
SMART Domains Protein: ENSMUSP00000108556
Gene: ENSMUSG00000075376
AA Change: R420*

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112936
AA Change: R420*
SMART Domains Protein: ENSMUSP00000108558
Gene: ENSMUSG00000075376
AA Change: R420*

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125619
AA Change: R420*
SMART Domains Protein: ENSMUSP00000145082
Gene: ENSMUSG00000075376
AA Change: R420*

DomainStartEndE-ValueType
RING 14 53 1.4e-7 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 6.9e-6 SMART
low complexity region 455 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204962
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a knock-out allele are viable and healthy but show increased TNF production by macrophages in response to LPS. Homozygotes for a different knock-out allele show postnatal lethality, decreased body size and weight, and an immature lung phenotype with decreased alveolar expansion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Rc3h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Rc3h2 APN 2 37389747 missense possibly damaging 0.59
IGL00944:Rc3h2 APN 2 37398238 splice site probably benign
IGL01065:Rc3h2 APN 2 37377844 splice site probably benign
IGL01966:Rc3h2 APN 2 37382777 splice site probably benign
IGL02123:Rc3h2 APN 2 37398253 missense probably damaging 1.00
IGL02174:Rc3h2 APN 2 37411225 missense probably benign 0.11
IGL02448:Rc3h2 APN 2 37389805 missense probably benign 0.08
IGL02539:Rc3h2 APN 2 37389715 missense probably benign 0.09
IGL02698:Rc3h2 APN 2 37405300 missense probably damaging 0.99
IGL02731:Rc3h2 APN 2 37382811 missense probably benign 0.00
IGL02958:Rc3h2 APN 2 37414700 missense probably damaging 1.00
IGL02959:Rc3h2 APN 2 37405354 missense probably damaging 1.00
R0309:Rc3h2 UTSW 2 37379008 splice site probably benign
R0488:Rc3h2 UTSW 2 37389588 missense probably damaging 0.99
R0506:Rc3h2 UTSW 2 37376659 critical splice donor site probably null
R0612:Rc3h2 UTSW 2 37411215 missense possibly damaging 0.77
R0628:Rc3h2 UTSW 2 37382052 splice site probably benign
R0647:Rc3h2 UTSW 2 37409530 missense probably damaging 1.00
R0680:Rc3h2 UTSW 2 37399835 missense probably damaging 0.97
R0738:Rc3h2 UTSW 2 37405374 missense probably damaging 1.00
R2005:Rc3h2 UTSW 2 37389753 nonsense probably null
R2105:Rc3h2 UTSW 2 37399624 missense possibly damaging 0.89
R2133:Rc3h2 UTSW 2 37378916 missense probably benign 0.12
R2373:Rc3h2 UTSW 2 37379001 missense possibly damaging 0.94
R2414:Rc3h2 UTSW 2 37399819 critical splice donor site probably null
R2850:Rc3h2 UTSW 2 37377415 missense probably benign
R2913:Rc3h2 UTSW 2 37378959 missense possibly damaging 0.89
R2932:Rc3h2 UTSW 2 37378359 missense probably benign 0.10
R4441:Rc3h2 UTSW 2 37414514 critical splice donor site probably null
R4932:Rc3h2 UTSW 2 37389832 missense possibly damaging 0.77
R5114:Rc3h2 UTSW 2 37398361 splice site probably null
R5169:Rc3h2 UTSW 2 37405312 missense probably damaging 1.00
R5360:Rc3h2 UTSW 2 37389855 missense possibly damaging 0.59
R5477:Rc3h2 UTSW 2 37399630 missense possibly damaging 0.94
R5776:Rc3h2 UTSW 2 37378313 missense possibly damaging 0.59
R5842:Rc3h2 UTSW 2 37378371 missense possibly damaging 0.77
R5935:Rc3h2 UTSW 2 37414733 frame shift probably null
R6060:Rc3h2 UTSW 2 37399600 missense possibly damaging 0.77
R6112:Rc3h2 UTSW 2 37378887 missense possibly damaging 0.59
R6172:Rc3h2 UTSW 2 37414733 frame shift probably null
R6173:Rc3h2 UTSW 2 37414733 frame shift probably null
R6177:Rc3h2 UTSW 2 37389646 missense probably benign 0.02
R6455:Rc3h2 UTSW 2 37409470 missense probably damaging 1.00
R6457:Rc3h2 UTSW 2 37411139 critical splice donor site probably null
R6467:Rc3h2 UTSW 2 37382016 missense probably damaging 0.97
R6647:Rc3h2 UTSW 2 37382944 nonsense probably null
R6694:Rc3h2 UTSW 2 37400543 missense probably damaging 1.00
R6695:Rc3h2 UTSW 2 37414661 missense possibly damaging 0.88
X0013:Rc3h2 UTSW 2 37389786 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GGAAACACGGATTCCAGTTTC -3'
(R):5'- AACTTGTTTCTGCATGCATGAG -3'

Sequencing Primer
(F):5'- CACGGATTCCAGTTTCTAAATATGAC -3'
(R):5'- CTGCATGCATGAGAATTATGTGTC -3'
Posted On2016-10-24