Incidental Mutation 'R5553:Piwil1'
ID435219
Institutional Source Beutler Lab
Gene Symbol Piwil1
Ensembl Gene ENSMUSG00000029423
Gene Namepiwi-like RNA-mediated gene silencing 1
SynonymsMIWI
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5553 (G1)
Quality Score216
Status Not validated
Chromosome5
Chromosomal Location128702524-128755474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128745501 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 392 (M392T)
Ref Sequence ENSEMBL: ENSMUSP00000142807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086056] [ENSMUST00000195959] [ENSMUST00000200192]
Predicted Effect probably benign
Transcript: ENSMUST00000086056
AA Change: M382T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083222
Gene: ENSMUSG00000029423
AA Change: M382T

DomainStartEndE-ValueType
GAGE 1 113 9.14e-25 SMART
Pfam:ArgoL1 228 276 4.6e-8 PFAM
PAZ 278 416 1.04e-76 SMART
Piwi 556 848 6.45e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195959
AA Change: M382T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142386
Gene: ENSMUSG00000029423
AA Change: M382T

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
PAZ 278 416 1.04e-76 SMART
Piwi 556 831 4.99e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200192
AA Change: M392T

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000142807
Gene: ENSMUSG00000029423
AA Change: M392T

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
low complexity region 57 68 N/A INTRINSIC
Blast:PAZ 214 280 5e-23 BLAST
PAZ 288 426 8e-81 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIWI subfamily of Argonaute proteins, evolutionarily conserved proteins containing both PAZ and Piwi motifs that play important roles in stem cell self-renewal, RNA silencing, and translational regulation in diverse organisms. The encoded protein may play a role as an intrinsic regulator of the self-renewal capacity of germline and hematopoietic stem cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male sterility due to a block in spermatogenesis beginning at the round spermatid stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Piwil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Piwil1 APN 5 128749973 missense possibly damaging 0.95
IGL01783:Piwil1 APN 5 128743826 missense probably benign 0.29
IGL01992:Piwil1 APN 5 128747332 missense probably null 1.00
IGL02079:Piwil1 APN 5 128742003 missense possibly damaging 0.89
IGL02212:Piwil1 APN 5 128750270 missense possibly damaging 0.90
IGL03133:Piwil1 APN 5 128742029 missense probably benign
IGL03352:Piwil1 APN 5 128751072 missense probably benign 0.29
R0032:Piwil1 UTSW 5 128743280 missense probably benign 0.00
R0032:Piwil1 UTSW 5 128743280 missense probably benign 0.00
R0139:Piwil1 UTSW 5 128747323 missense probably damaging 1.00
R0667:Piwil1 UTSW 5 128741478 splice site probably null
R0691:Piwil1 UTSW 5 128743307 missense probably null 1.00
R1146:Piwil1 UTSW 5 128747893 missense probably benign
R1146:Piwil1 UTSW 5 128747893 missense probably benign
R1854:Piwil1 UTSW 5 128747839 nonsense probably null
R2126:Piwil1 UTSW 5 128754096 missense probably damaging 0.99
R4878:Piwil1 UTSW 5 128740981 missense probably damaging 0.99
R5068:Piwil1 UTSW 5 128741614 missense probably damaging 0.98
R5413:Piwil1 UTSW 5 128743880 missense possibly damaging 0.80
R5936:Piwil1 UTSW 5 128751078 missense probably benign 0.24
R6158:Piwil1 UTSW 5 128747876 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGAACCATGGCTTCTGGAG -3'
(R):5'- TTGCGCATTTTATCAGTCAGG -3'

Sequencing Primer
(F):5'- ACGCGTTGTTAATGAGGCACTTAC -3'
(R):5'- TTATCAGTCAGGCCTGCAAC -3'
Posted On2016-10-24