Incidental Mutation 'R5553:Dot1l'
ID435229
Institutional Source Beutler Lab
Gene Symbol Dot1l
Ensembl Gene ENSMUSG00000061589
Gene NameDOT1-like, histone H3 methyltransferase (S. cerevisiae)
SynonymsmDot1, KMT4
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5553 (G1)
Quality Score217
Status Not validated
Chromosome10
Chromosomal Location80755206-80795461 bp(+) (GRCm38)
Type of Mutationsmall deletion (4 aa in frame mutation)
DNA Base Change (assembly) CCAGCCCCACCCTCAGCC to CCAGCC at 80783628 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105336] [ENSMUST00000127740] [ENSMUST00000150338]
Predicted Effect probably benign
Transcript: ENSMUST00000105336
SMART Domains Protein: ENSMUSP00000100973
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
Pfam:DOT1 115 317 9.4e-86 PFAM
low complexity region 335 348 N/A INTRINSIC
AT_hook 407 419 4.64e-1 SMART
low complexity region 437 447 N/A INTRINSIC
coiled coil region 558 647 N/A INTRINSIC
low complexity region 917 936 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1084 1095 N/A INTRINSIC
low complexity region 1145 1157 N/A INTRINSIC
low complexity region 1186 1198 N/A INTRINSIC
low complexity region 1436 1446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127740
Predicted Effect probably benign
Transcript: ENSMUST00000150338
SMART Domains Protein: ENSMUSP00000116581
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
Pfam:DOT1 1 100 3.4e-37 PFAM
low complexity region 118 131 N/A INTRINSIC
AT_hook 190 202 4.64e-1 SMART
low complexity region 220 230 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
SCOP:d1fxkc_ 396 441 1e-3 SMART
low complexity region 700 719 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 969 981 N/A INTRINSIC
low complexity region 1020 1032 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
low complexity region 1060 1105 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163526
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates lysine-79 of histone H3. It is inactive against free core histones, but shows significant histone methyltransferase activity against nucleosomes. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele show late embryonic lethality. Mice homozygous for a null allele die by E10.5 displaying a growth arrest, abnormal yolk sac angiogenesis and heart dilation while mutant ES cells show elevated apoptosis, G2 cell cycle arrest, telomere elongation and aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Dot1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01836:Dot1l APN 10 80785866 missense probably benign 0.00
IGL01915:Dot1l APN 10 80780894 missense probably damaging 0.99
IGL02287:Dot1l APN 10 80764609 missense possibly damaging 0.66
IGL02695:Dot1l APN 10 80777608 missense probably damaging 1.00
IGL03058:Dot1l APN 10 80790997 missense probably benign 0.00
IGL03071:Dot1l APN 10 80788679 missense probably benign 0.00
IGL03120:Dot1l APN 10 80786273 splice site probably benign
R0220:Dot1l UTSW 10 80785858 missense probably damaging 0.99
R1342:Dot1l UTSW 10 80786025 missense probably benign 0.14
R1701:Dot1l UTSW 10 80790742 missense possibly damaging 0.93
R1862:Dot1l UTSW 10 80783539 missense probably damaging 1.00
R2094:Dot1l UTSW 10 80785878 missense probably damaging 1.00
R2308:Dot1l UTSW 10 80789069 missense probably damaging 1.00
R4274:Dot1l UTSW 10 80783988 critical splice donor site probably null
R4617:Dot1l UTSW 10 80785084 missense probably damaging 0.97
R4623:Dot1l UTSW 10 80782150 missense probably benign 0.18
R4690:Dot1l UTSW 10 80786182 nonsense probably null
R5009:Dot1l UTSW 10 80771196 missense probably benign 0.25
R5072:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5073:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5074:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5305:Dot1l UTSW 10 80790793 missense probably benign 0.03
R5312:Dot1l UTSW 10 80784637 missense possibly damaging 0.94
R5512:Dot1l UTSW 10 80788991 missense possibly damaging 0.92
R5551:Dot1l UTSW 10 80783628 small deletion probably benign
R5552:Dot1l UTSW 10 80783628 small deletion probably benign
R6056:Dot1l UTSW 10 80786095 missense probably damaging 0.96
R6207:Dot1l UTSW 10 80786443 missense probably benign 0.06
R6419:Dot1l UTSW 10 80791481 missense possibly damaging 0.85
R6782:Dot1l UTSW 10 80789390 missense probably damaging 1.00
X0066:Dot1l UTSW 10 80788683 missense possibly damaging 0.94
X0066:Dot1l UTSW 10 80788684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGATTCTGGTGCTGAGGAAG -3'
(R):5'- ACCATGGTCCCACACTACTG -3'

Sequencing Primer
(F):5'- AAAATCAGGTGTGGCTACTGTC -3'
(R):5'- CTGTGGGCAACAAACTTGTC -3'
Posted On2016-10-24