Incidental Mutation 'R5553:Grin2c'
ID435233
Institutional Source Beutler Lab
Gene Symbol Grin2c
Ensembl Gene ENSMUSG00000020734
Gene Nameglutamate receptor, ionotropic, NMDA2C (epsilon 3)
SynonymsNR2C, GluRepsilon3, NMDAR2C
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115249169-115267243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115252725 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 736 (M736I)
Ref Sequence ENSEMBL: ENSMUSP00000102164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003351] [ENSMUST00000106554]
Predicted Effect probably null
Transcript: ENSMUST00000003351
AA Change: M736I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003351
Gene: ENSMUSG00000020734
AA Change: M736I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 99 299 5.1e-12 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 924 6.8e-15 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106554
AA Change: M736I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102164
Gene: ENSMUSG00000020734
AA Change: M736I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 100 306 6.9e-10 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 926 1.1e-13 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158919
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deficits in motor coordination and reduced granule cell responses to N-methy-D-aspartate in brain slices. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Grin2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Grin2c APN 11 115258110 missense possibly damaging 0.94
IGL01306:Grin2c APN 11 115256194 missense probably benign 0.01
IGL01408:Grin2c APN 11 115260882 missense probably damaging 1.00
IGL01539:Grin2c APN 11 115250106 missense probably benign 0.32
IGL01931:Grin2c APN 11 115253910 missense probably damaging 1.00
IGL01964:Grin2c APN 11 115253847 missense probably damaging 1.00
IGL02796:Grin2c APN 11 115250717 splice site probably benign
IGL02956:Grin2c APN 11 115257959 missense possibly damaging 0.86
IGL03221:Grin2c APN 11 115254044 splice site probably benign
ANU23:Grin2c UTSW 11 115256194 missense probably benign 0.01
R0011:Grin2c UTSW 11 115255750 missense probably damaging 1.00
R0011:Grin2c UTSW 11 115255750 missense probably damaging 1.00
R0112:Grin2c UTSW 11 115251134 missense probably damaging 1.00
R0355:Grin2c UTSW 11 115260728 splice site probably benign
R0681:Grin2c UTSW 11 115249653 missense probably benign
R0791:Grin2c UTSW 11 115250646 missense probably damaging 1.00
R0792:Grin2c UTSW 11 115250646 missense probably damaging 1.00
R1512:Grin2c UTSW 11 115253850 missense probably damaging 1.00
R1572:Grin2c UTSW 11 115256074 missense possibly damaging 0.92
R1654:Grin2c UTSW 11 115260853 missense probably benign 0.21
R1803:Grin2c UTSW 11 115260732 critical splice donor site probably null
R1982:Grin2c UTSW 11 115260905 missense possibly damaging 0.96
R2050:Grin2c UTSW 11 115257419 missense possibly damaging 0.89
R2196:Grin2c UTSW 11 115250666 missense probably benign 0.34
R2442:Grin2c UTSW 11 115251134 missense probably damaging 1.00
R2509:Grin2c UTSW 11 115251068 nonsense probably null
R3440:Grin2c UTSW 11 115250643 missense probably damaging 1.00
R3965:Grin2c UTSW 11 115260994 missense probably damaging 1.00
R4618:Grin2c UTSW 11 115252747 missense probably damaging 1.00
R4735:Grin2c UTSW 11 115249596 missense possibly damaging 0.63
R4856:Grin2c UTSW 11 115260790 missense probably damaging 1.00
R4886:Grin2c UTSW 11 115260790 missense probably damaging 1.00
R5277:Grin2c UTSW 11 115253813 missense probably damaging 1.00
R5334:Grin2c UTSW 11 115256055 missense possibly damaging 0.76
R5711:Grin2c UTSW 11 115250289 missense probably benign 0.32
R5784:Grin2c UTSW 11 115258295 missense possibly damaging 0.94
R5849:Grin2c UTSW 11 115260991 missense probably benign
R6421:Grin2c UTSW 11 115251130 missense probably damaging 1.00
R6461:Grin2c UTSW 11 115255696 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTGGAACCTAGAACTGATGGAAC -3'
(R):5'- GAGGCACTGTATATTCTTGGGC -3'

Sequencing Primer
(F):5'- GGAACCTAGAACTGATGGAACTCACC -3'
(R):5'- CCTACCCTTTCTGAGAAATGAGG -3'
Posted On2016-10-24