Incidental Mutation 'R5553:Nubpl'
ID435234
Institutional Source Beutler Lab
Gene Symbol Nubpl
Ensembl Gene ENSMUSG00000035142
Gene Namenucleotide binding protein-like
Synonyms2410170E07Rik
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location52097737-52312744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52181299 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 169 (L169M)
Ref Sequence ENSEMBL: ENSMUSP00000044292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040090] [ENSMUST00000159567]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040090
AA Change: L169M

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044292
Gene: ENSMUSG00000035142
AA Change: L169M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ParA 65 311 1.6e-101 PFAM
Pfam:AAA_31 68 131 2.6e-9 PFAM
Pfam:MipZ 68 217 2.8e-9 PFAM
Pfam:CbiA 70 241 9.9e-17 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159567
AA Change: L117M
SMART Domains Protein: ENSMUSP00000125177
Gene: ENSMUSG00000035142
AA Change: L117M

DomainStartEndE-ValueType
PDB:2PH1|A 12 113 4e-9 PDB
SCOP:d1ihua2 31 122 3e-7 SMART
Blast:AAA 40 115 1e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162111
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Mrp/NBP35 ATP-binding proteins family. The encoded protein is required for the assembly of the respiratory chain NADH dehydrogenase (complex I), an oligomeric enzymatic complex located in the inner mitochondrial membrane. Mutations in this gene cause mitochondrial complex I deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Nubpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Nubpl APN 12 52305855 missense probably damaging 0.96
IGL01415:Nubpl APN 12 52271070 missense possibly damaging 0.91
IGL02538:Nubpl APN 12 52310694 splice site probably benign
IGL02644:Nubpl APN 12 52271058 missense probably damaging 0.99
R0060:Nubpl UTSW 12 52310687 splice site probably benign
R0060:Nubpl UTSW 12 52310687 splice site probably benign
R3851:Nubpl UTSW 12 52144027 missense probably damaging 1.00
R4939:Nubpl UTSW 12 52181095 missense probably damaging 0.98
R5691:Nubpl UTSW 12 52105276 intron probably benign
R5886:Nubpl UTSW 12 52181309 critical splice donor site probably null
R6654:Nubpl UTSW 12 52310733 missense probably damaging 1.00
R6899:Nubpl UTSW 12 52310753 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTAATGAGGCCTCTTTTGAATTATGG -3'
(R):5'- TTACACTAAGATGCAACAGGAAGAC -3'

Sequencing Primer
(F):5'- AGGCCTCTTTTGAATTATGGTATTGC -3'
(R):5'- CAGGAAGACTAAGTTGGTGTAATTTG -3'
Posted On2016-10-24