Incidental Mutation 'R5553:Irf4'
ID435235
Institutional Source Beutler Lab
Gene Symbol Irf4
Ensembl Gene ENSMUSG00000021356
Gene Nameinterferon regulatory factor 4
SynonymsIRF-4, Spip
MMRRC Submission 043110-MU
Accession Numbers

Genbank: NM_013674; MGI: 1096873

Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location30749226-30766976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30751828 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 122 (Y122C)
Ref Sequence ENSEMBL: ENSMUSP00000105936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021784] [ENSMUST00000110307] [ENSMUST00000222125]
Predicted Effect probably damaging
Transcript: ENSMUST00000021784
AA Change: Y122C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021784
Gene: ENSMUSG00000021356
AA Change: Y122C

DomainStartEndE-ValueType
IRF 17 130 6.96e-64 SMART
IRF-3 249 418 1.17e-84 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110307
AA Change: Y122C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105936
Gene: ENSMUSG00000021356
AA Change: Y122C

DomainStartEndE-ValueType
IRF 17 130 6.96e-64 SMART
IRF-3 248 417 1.17e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222125
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6;14)(p25;q32), may be a cause of multiple myeloma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display immune system abnormalities involving development of both T and B cells and affecting susceptibility to both bacterial and viral infections as well as impaired thermogenic gene expression and energy expenditure. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Irf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Irf4 APN 13 30751784 missense probably damaging 1.00
IGL01154:Irf4 APN 13 30757421 missense possibly damaging 0.46
IGL01669:Irf4 APN 13 30757471 missense probably damaging 0.99
IGL02729:Irf4 APN 13 30753591 critical splice donor site probably null
IGL03197:Irf4 APN 13 30763520 splice site probably benign
honey UTSW 13 30751751 missense probably damaging 1.00
Honey2 UTSW 13 30761490 splice donor site probably benign
R1300:Irf4 UTSW 13 30757585 missense probably damaging 0.98
R1656:Irf4 UTSW 13 30757502 missense probably benign
R1914:Irf4 UTSW 13 30761462 missense probably benign 0.00
R1915:Irf4 UTSW 13 30761462 missense probably benign 0.00
R3889:Irf4 UTSW 13 30761490 splice site probably benign
R4648:Irf4 UTSW 13 30763597 missense probably benign 0.00
R5913:Irf4 UTSW 13 30757758 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGACGCTCTGGGCTTGAC -3'
(R):5'- TCTGCCAGGTCATCCTATACTAAC -3'

Sequencing Primer
(F):5'- GACGCTCTGGGCTTGACTTTTC -3'
(R):5'- CCACAGGGTTGTCACTTATAACAGAG -3'
Posted On2016-10-24