Incidental Mutation 'R5553:A1bg'
ID435236
Institutional Source Beutler Lab
Gene Symbol A1bg
Ensembl Gene ENSMUSG00000022347
Gene Namealpha-1-B glycoprotein
SynonymsC44
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location60896859-60923012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60920841 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 86 (I86F)
Ref Sequence ENSEMBL: ENSMUSP00000094151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096418] [ENSMUST00000228632]
Predicted Effect probably damaging
Transcript: ENSMUST00000096418
AA Change: I86F

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094151
Gene: ENSMUSG00000022347
AA Change: I86F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG_like 34 109 1.09e2 SMART
Blast:IG_like 137 215 5e-15 BLAST
Pfam:Ig_2 223 314 8.8e-11 PFAM
IG 328 415 1.32e-3 SMART
IG_like 426 511 9.21e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228929
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in A1bg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:A1bg APN 15 60921253 missense probably damaging 0.98
IGL01622:A1bg APN 15 60917893 missense possibly damaging 0.66
IGL01623:A1bg APN 15 60917893 missense possibly damaging 0.66
IGL03131:A1bg APN 15 60919756 missense probably damaging 1.00
IGL03162:A1bg APN 15 60919732 missense probably damaging 0.99
IGL03356:A1bg APN 15 60919888 missense probably benign 0.00
R0009:A1bg UTSW 15 60919633 unclassified probably benign
R0009:A1bg UTSW 15 60919633 unclassified probably benign
R0014:A1bg UTSW 15 60919732 missense probably damaging 0.99
R1084:A1bg UTSW 15 60918155 unclassified probably benign
R1199:A1bg UTSW 15 60919635 critical splice donor site probably null
R4212:A1bg UTSW 15 60919736 missense possibly damaging 0.91
R4543:A1bg UTSW 15 60917900 missense probably damaging 1.00
R4835:A1bg UTSW 15 60920251 missense probably benign 0.00
R5404:A1bg UTSW 15 60919696 missense probably benign 0.02
R5580:A1bg UTSW 15 60919032 missense probably benign 0.09
R5583:A1bg UTSW 15 60921234 missense probably damaging 1.00
R5825:A1bg UTSW 15 60920127 nonsense probably null
R5937:A1bg UTSW 15 60919646 missense probably benign 0.22
R6021:A1bg UTSW 15 60919864 missense possibly damaging 0.84
R6193:A1bg UTSW 15 60920780 missense probably benign 0.00
R6565:A1bg UTSW 15 60920810 missense probably damaging 1.00
R6870:A1bg UTSW 15 60919715 missense probably damaging 1.00
R6939:A1bg UTSW 15 60920395 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGGATCGAAGCTTCTCCATC -3'
(R):5'- AATGGCCTATGGGTTACGGG -3'

Sequencing Primer
(F):5'- GGATCGAAGCTTCTCCATCTATTTTC -3'
(R):5'- TTCTGGCAGTGAACCTAAACTATGGG -3'
Posted On2016-10-24